BME103:W930 Group9 l2: Difference between revisions
Hamas Asaad (talk | contribs) |
Seth Howell (talk | contribs) |
||
| (2 intermediate revisions by one other user not shown) | |||
| Line 153: | Line 153: | ||
'''Primer Design''' | '''Primer Design'''<br> | ||
Forward primer<br> | Forward primer<br> | ||
5'AAAAAAACAATCTTTTAAACAC3'<br> | 5'AAAAAAACAATCTTTTAAACAC3'<br> | ||
| Line 159: | Line 159: | ||
3'TGTTTACTTACCGTAGCTTC5'<br> | 3'TGTTTACTTACCGTAGCTTC5'<br> | ||
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | ||
'''Illustration''' | '''Illustration''' | ||
<br> | |||
[[Image:Cf1.png|250px|DNA Amplification]] | [[Image:Cf1.png|250px|DNA Amplification]] | ||
<br> | |||
The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Latest revision as of 01:07, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||
|
OUR TEAM
Everyone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
The KeyPad will be detachable, and will be connected through the USB connection. Key Features
The key features of the new design include a larger main heating block and a Instructions The new OpenPCR will be assembled and operated almost identical to the old OpenPCR.
ProtocolsMaterials
PCR Protocol *important* Use one pipet for each transfer do not reuse the pipet. 3. After the DNA priming mixture is transferred move each tube into the PCR machine. a. Enter in the number of parts the heating portion will have(example First cycle, Main cycle and Last cycle=3).
1. Place the flourimeter on the table and turn on the blue light. 1. Take a picture of the fluorimeter assembly with a smartphone. Research and DevelopmentBackground on Disease Markers
Illustration
The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. | |||||||






