BME103:T930 Group 13 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 100: Line 100:




<font size="7">'''PCR Protocol</font>
<font size="4">'''PCR Protocol</font>








<font size="7">'''DNA Measurement Protocol'''</font>
<font size="4">'''DNA Measurement Protocol'''</font>


==Research and Development==
==Research and Development==

Revision as of 04:49, 29 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

THE A TEAM

Name: Marcus Sansoni
Open PCR Machine Engineer
Name: Pete Marple
Open PCR Machine Engineer
Name: Michelle Lipowicz
Experimental Protocol Planner
Name: Allen Janis
R&D Scientist
Name: Ian Bainbridge
R&D Scientist
Name: Tyler Barnes
Open PCR Machine Engineer

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
https://myasucourses.asu.edu/courses/1/2012Fall-T-BME103-86053-86055-86054/groups/_185919_1//_7764570_1/fan.png https://myasucourses.asu.edu/courses/1/2012Fall-T-BME103-86053-86055-86054/groups/_185919_1//_7764575_1/heat%20sink.png

System Design
The Heat Sink Fan moves air across the metal sheets to cool down the PCR machine and the samples. The Heat Sink removes heat from the PCR machine to cool down the samples. It does this by conducting heat down to the metal sheets that are located beside the heat sink fan.

Key Features
For the Heat Sink Fan, we want to add a second fan to the PCR machine. The reason for adding an additional fan would be cool the heat sink down more rapidly. We also want to change the heat sink in general by add more surface area to the metal sheets in the center. We would increase the number of sheets vertically, reducing space between sheets, and we would also add two to three sheets horizontally, to increase the surface area even more.

Instructions
The instructions for assembly or use of the machine would not change. To add the second fan, though, we would have to expand the exterior walls to make room for it. This would make the machine slightly larger, but not change its compact, portable size.

Protocols

Materials


Supplied in Kit Amount
PCR machine
buffer 3200 mL
Eppendorf 12
sybr green solution full Eppendorf tube
DNA calf thymus 2 microg/mL (full Eppendorf tube)
pipettes 20
glass slides 5
black box
buffer 4000mL
master mix 100 μL
phone holder
scintillation vial
light box



Supplied by User
waste cup
paper towels
smart phone with camera
computer with Image J program
sharpie pen
power source



PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers


Cystic fibrosis is a disease that can be passed on down genetically along the familial line. The disease causes a build up of thick mucus on the inside of the lungs, digestive tract and other parts of the body. Cystic Fibrosis is the most common chronic lung disease to effect children and young adults and is usually diagnosed by the age of two; however, there are weaker strains of the disease that often go un-diagnosed until the age of 18 or later. The disease is recessive so to suffer the disease one must have the gene from both parents. The disease is life-threatening, the mucus builds up and can eventually suffocate the victim. Around 1 in 29 Caucasians of middle European dissent suffer from cystic fibrosis, this is the most susceptible group to this disease.

One such SNP which signals for a susceptibility to Cystic Fibrosis is the [A/G] swap changing the codon from TGG ⇒ TGA. This change has been recorded in two patients suffering from cystic fibrosis the swap occurs at nucleotide 302 in exon 3 converting codon 57 from TGG (trp) to TGA (stop).

More information can be found: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121909025


Primer Design

The primers must be built around the sequence CGTCTCTAC[T/C]CTATCTCTC with the thymine swapped for the cytosine giving the primers:

Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5'

Forward primer: 5' AAATATCTGGCTGAGTGTTT 3'

These primers are 150 bp apart so as to allow the PCR reaction to occur faster, shortening the 30 seconds required per temperature cycled to 10 seconds per cycle.



Illustration



Forward and reverse primers binding to the SNP signaling Cystic Fibrosis.


<http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg>


Image credit to www.nature.com Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012.

General PCR is very similar to our new version of PCR. The only difference is that our primers are only fifteen base pairs long and will be only 150 base pairs apart. So each copied segment in this illustration is 150 base pairs long and the primers look like the first illustration.