BME103:T130 Group 11 l2: Difference between revisions
Sharon Gooi (talk | contribs) |
|||
| Line 93: | Line 93: | ||
| '''Supplied in the Kit''' || style="width: 400px;" | '''Amount''' | | '''Supplied in the Kit''' || style="width: 400px;" | '''Amount''' | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| SYBR Green I || style="width: 400px;" | | | SYBR Green I || style="width: 400px;" | 800 μL | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Calf Thymus DNA || style="width: 400px;" | | | Calf Thymus DNA || style="width: 400px;" | 800 μL | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| PCR tubes || style="width: 400 px;" | 95 tubes | | PCR tubes || style="width: 400 px;" | 95 tubes | ||
| Line 103: | Line 103: | ||
| Positive control || style="width: 400 pxl" | 1 | | Positive control || style="width: 400 pxl" | 1 | ||
|- style="height: 50 px;" | |- style="height: 50 px;" | ||
| Pipettes || style="width: 400 px;" | | | Pipettes || style="width: 400 px;" | 100 pipettes | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Microtubes || style="width: 400px;" | 93 tubes | | Microtubes || style="width: 400px;" | 93 tubes | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| | | Negative control || style="width: 400 px;" | 100 μL | ||
|- style="height: 50 px;" | |||
| Positive control || style="width:400 px;" | 100 μL | |||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Fluorimeter || style="width: 400 px;" | 1 | | Fluorimeter || style="width: 400 px;" | 1 | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| | | Smartphone stand || style="width: 400 px;" | 1 | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| CD with ImageJ software || style="width: 400 px;" | 1 | | CD with ImageJ and OpenPCR software || style="width: 400 px;" | 1 | ||
|- style="height:50 px;" | |||
| Primer 1 || style="width:400px;" | 20 ml | |||
|- style="height:50 px;" | |||
| Primer 2 || style="width:400px;" | 20 ml | |||
|- style="height:50px;" | |||
| Glass slides || style="width:400px;" | 20 | |||
|- style="height:50 px;" | |||
| Buffer || style="width:400px;" | 40 ml | |||
|- style="height:50 px;" | |||
| Eppendorf tubes || style="width: 400 px;" | 95 tubes | |||
|- style="height: 50 px;" | |||
| Box for fluorimeter || style"width: 400 px;" | 1 | |||
|} | |} | ||
| Line 128: | Line 142: | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Heatproof marker pen || style="width: 400 px;" | 1 | | Heatproof marker pen || style="width: 400 px;" | 1 | ||
|- | |- style="height: 50px;" | ||
| Cup for waste || style="width: 400 px;" | 1 | |||
|} | |} | ||
| Line 162: | Line 177: | ||
After the heating and cooling cycles were done, all of the PCR tubes were taken out of the PCR machine. 95 | After the heating and cooling cycles were done, all of the PCR tubes were taken out of the PCR machine. 95 Eppendorf tubes were filled with 400μL of buffer. Using separate pipettes for each tube (all of which were labelled according to the corresponding tube), all of the samples as well as the controls were transferred into these Eppendorf tubes. Each Eppendorf tube was labelled by the sample, as was earlier done for the PCR tubes, using the marker. Another Eppendorf tube was filled with the calf thymus DNA (standard at 2 micrograms/ml), and this tube was marked with a red dot on the top of the tube, using a marker. A scintillation vial was filled with deionized water, and another Eppendorf tube was almost completely filled with the SYBR Green I solution. The Eppendorf tube containing the SYBR Green I was marked on the top with a blue dot. | ||
Revision as of 06:02, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
In order to increase tube space, we increase the heating plate and increase the power proportionally to the size of the plate. We would also add more ventilation next to the heating plate in order to speed up the cooling process of the DNA. Key Features
Stage one: 1 cycle, 95 Degrees C for 3 minutes Stage two: 35 cycles, 95 Degrees C for 30 seconds, 57 Degrees C for 30 seconds, 72 Degrees C for 30 seconds Stage three: 72 Degrees C for 3 minutes Final hold: 4 Degrees C For the PCR reaction mix, up to 96 tubes (50 uL each). The mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer. Use transfer pipetts (only use each pipette once) to transfer the samples. After placing the samples in the tube space and securing the lid, begin the PCR Machine and wait until completion.
ProtocolsMaterials
PCR Protocol
Research and DevelopmentCystic Fibrosis is a genetically inherited disease that is derived from the production of excessive mucous build up in the respiratory tract. This has a major effect on the body's endocrine system, more specifically in the digestive and respiratory systems.
More information on the gene can be found at http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35731153
The forward primer for this disease would be CAGTCGCAGACGGAGAGGCAT while the reverse primer for without the disease would be GTCAGCGTCTCCCTCTCCGTA. If the patient was positive for the cystic fibrosis mutation, the reverse primer would be GTCAGCGTCTGCCTCTCCGTA. The difference between the mutation and the normal strand is that the normal strand has the allele TCC where the mutation has TGC. So the C and the G is changed. When the primer is made and put into the PCR machine, it will only attach to the mutation strands. If the primer matches up, it will glow under a black light therefore indicating that the patient has the disease. If there is no glow, that means the patient does not have that type of cystic fibrosis.
Illustration
| |||||||||||||||||||||||||||||||||||||||||||||||||||


