BME103:T930 Group 11 l2: Difference between revisions
Tony Nguyen (talk | contribs) |
|||
| Line 172: | Line 172: | ||
"Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. The most common problem in almost all men as they grow older is an enlarged prostate.[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] | "Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. The most common problem in almost all men as they grow older is an enlarged prostate.[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] | ||
An image of a normal prostate and cancer prostate[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/figure/A000380.B18038/?report=objectonly] | |||
The marker that is being use was rs137852593[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121913297] | |||
The Dna Sequence is TCAAACGTGTTTTGATCAAAGAAGAG[G/T]AGTATGATTCTATTATAGTATTCTA[http://www.ncbi.nlm.nih.gov/snp?term=121913297] and found in chromosome 13. | |||
'''Primer Design''' | |||
If the sample carries the mutation, then the sample would test positive. If it does not, then the sample would test negative because the primers would not be able to bind to the DNA because it does not contain the proper sequence. | If the sample carries the mutation, then the sample would test positive. If it does not, then the sample would test negative because the primers would not be able to bind to the DNA because it does not contain the proper sequence. | ||
Revision as of 07:46, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||
OUR TEAM: Group 11LAB 2 WRITE-UPThermal Cycler EngineeringSystem Design Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. Our new design incorporates some new designs such as software, screen zize, number of testing tube lots, as well as size of heating lid. All of these alterations are made to make the Open PCR system more efficient in terms of its operating system and user-friendly features.
Our most major change to the Open PCR System is the change we made to the read-out screen on the top of the device near the heating lid. This change actually affects a few major components of our system. Not only did we move the screen to the side of the machine, rather than the top, but we also optimized the size of it. This size-change allows users to see the read-outs clearer. We also eliminated the need for a computer (or any outside device, that is) as this new larger screen will also be able to control the machine. Now the user is able to input cycles, temperature, etc. right on the screen instead of needing to plug it into a separate system. This allows for better portability and easier use. We also changed the space of the testing tubes so now more tubes can be tested at once. To do this we lengthened the plate as well as the heating lid entirely across the top of the machine. Removing the screen from this part of the Open PCR System also allowed for this change. Instructions
ProtocolsMaterials
PCR Protocol
DNA Measurement Protocol
Research and DevelopmentBackground on Disease Markers Prostate Cancer: retinoblastoma 1 "Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[1] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. The most common problem in almost all men as they grow older is an enlarged prostate.[2] An image of a normal prostate and cancer prostate[3] The marker that is being use was rs137852593[4] The Dna Sequence is TCAAACGTGTTTTGATCAAAGAAGAG[G/T]AGTATGATTCTATTATAGTATTCTA[5] and found in chromosome 13.
If the sample carries the mutation, then the sample would test positive. If it does not, then the sample would test negative because the primers would not be able to bind to the DNA because it does not contain the proper sequence.
| ||||||||||||||||||||||||||||







