BME103:T930 Group 17 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(41 intermediate revisions by 3 users not shown)
Line 15: Line 15:
| [[Image:Doug Steinhauff.jpg|100px|thumb| Doug Steinhauff (R&D Scientist)]]
| [[Image:Doug Steinhauff.jpg|100px|thumb| Doug Steinhauff (R&D Scientist)]]
| [[Image:385430_10150382756581863_296847512_n.jpg|100px|thumb| Kaleia Kramer (Open PCR Machine Engineer)]]
| [[Image:385430_10150382756581863_296847512_n.jpg|100px|thumb| Kaleia Kramer (Open PCR Machine Engineer)]]
| [[Image:BME103student.jpg|100px|thumb|Name: Student<br>Role(s)]]
| [[Image:399013 328732870488811 483210505 n.jpg|100px|thumb| Kathleen Farrell (Protocol and Procedures)]]
| [[Image:CarsonBridgers.jpg|100px|thumb|Carson Bridgers: <br>Role(s)]]
| [[Image:CarsonBridgers.jpg|100px|thumb|Carson Bridgers (Open PCR Machine Engineer]]
|}
|}


Line 29: Line 29:
'''System Design'''<br>
'''System Design'''<br>
[[Image:Overall_machine.png|200px]] <br>
[[Image:Overall_machine.png|200px]] <br>
''
'''This is the original Open PCR Machine.''' <br>''


An Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees Celsius to create a hot-start for DNA polymerization that requires heat activation. The second step is to denature the protein, where the first cycling event heats the DNA strands at a temperature of 95 degrees Celsius for 30 seconds to melt the DNA template through the disruption of hydrogen bonding between paired bases, effectively splitting the double stranded helix into two single strands of DNA. The third step is the annealing step where the temperature is rapidly lowered to around 50 degrees Celsius to allow for the annealing of primers. The polymerase then binds to the hybrid of primers with the template to begin DNA formation. Then begins the elongation step, which differs depending on the polymerase used; typically the optimum temperature is around 75 degrees Celsius. During the elongation process, DNA polymerase synthesizes a complementary new strand of anti-parallel DNA. The amount of time required for elongation differs depending on the DNA polymerase used as well as the length of the amplified DNA fragments being used. On average, DNA polymerase amplifies at a rate of one thousand bases per minute. Next is the final elongation step where the temperature is held around 75 degrees Celsius to ensure that the DNA strand is fully elongated and will generally hold for around five minutes. Finally there is an end hold temperature that keeps the reaction at a steady temperature (between four and fifteen degrees) until the amplified DNA is ready to be utilized and further studied.
''This is the original Open PCR Machine''<br>


[[Image:PCR_sample_holder_part_2.png|100px]] <br>
The originally designed Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees Celsius to create a hot-start for DNA polymerization that requires heat activation. The second step is to denature the protein, where the first cycling event heats the DNA strands at a temperature of 95 degrees Celsius for 30 seconds to melt the DNA template through the disruption of hydrogen bonding between paired bases, effectively splitting the double stranded helix into two single strands of DNA. The third step is the annealing step where the temperature is rapidly lowered to around 50 degrees Celsius to allow for the annealing of primers. The polymerase then binds to the hybrid of primers with the template to begin DNA formation. Then begins the elongation step, which differs depending on the polymerase used; typically the optimum temperature is around 75 degrees Celsius. During the elongation process, DNA polymerase synthesizes a complementary new strand of anti-parallel DNA. The amount of time required for elongation differs depending on the DNA polymerase used as well as the length of the amplified DNA fragments being used. On average, DNA polymerase amplifies at a rate of one thousand bases per minute. Next is the final elongation step where the temperature is held around 75 degrees Celsius to ensure that the DNA strand is fully elongated and will generally hold for around five minutes. Finally there is an end hold temperature that keeps the reaction at a steady temperature (between four and fifteen degrees) until the amplified DNA is ready to be utilized and further studied.


'''''This is the Sample Holder''' <br>''
The Open PCR machine has several pros and cons. In hopes to improve efficacy and speed, our lab group has suggested several ways that the Open PCR machine can be modified to speed up the process, save energy, and provide extra insulation to prevent heat loss during the initial heating period. In addition, we also increased the size of the sample wells so that insulation, which in turn increases efficacy by distributing the heat applied to the samples in a way that requires less heat. Also, the heat sink and fan are among the least efficient components of the Open PCR machine as a whole. Thus, we intend to update both our fan and heat sink. The cooling components in between heating cycles take up the most time and doesn't cool evenly. With an updated and more advanced fan will hopefully shorten the time needed for the Open PCR system to operate. Finally, the heat sink is smaller than it needs to be. By increasing the number of plates in the heat sink and decreasing the size of each plate, there will be smaller gaps between plates, allowing the heat projected to dramatically increase. With the addition of a more efficient fan, the additional heat shouldn't cause any problems, and the summation of the changes should cut out a percentage of time required for the Open PCR machine to run.


In this image the top has been moved aside so that the sample holder is visible. The sample holder keeps the samples in place while the PCR machine cycles. The heated lid tightens so that the inside of the lid will press against the samples without crushing them to ensure that they are heated quickly and evenly.
[[Image:Sample Wells.png|300px]] <br>


To improve this part and increase the heating rate we would widen the sample wells slightly so that insulation would be able to be placed inside them, then the whole sample block would be able to be heated without melting the plastic. This is an improvement over the previous design since it currently only heats through the lid, and this is inefficient since the surface contact between the sample tubes and the top is very small.
''This is the Sample Holder and Heated Lid''<br>


[[Image:Heat_Sink_&_Fan_part_4.png|100px]] <br>
In this image the top has been moved aside so that the sample holder is visible separately from the heated lid itself. The sample holder keeps the samples in place while the PCR machine cycles. The heated lid tightens so that the inside of the lid will press against the samples without crushing them to ensure that they are heated quickly and evenly.


'''''This is the Heat Sink and Fan''' <br>''
To improve this part and increase the heating rate we would widen the sample wells slightly so that insulation would be able to be placed inside them, then the whole sample block would be able to be heated without melting the plastic. This is an improvement over the current design due to the fact that it currently only heats through the lid. Heating solely through the lid is inefficient because the heated lid only comes in contact with the caps of the samples, not only is this the thickest point of the sample container, but it is also the furthest from the liquid contained in the bottom of the sample containers. By adding insulation to the sample wells we increase the heating capacity of the samples themselves as well as improving efficiency, if heat is distributed more evenly, less heat is required to allow the samples to reach the optimal temperature for each step. In addition, we wanted to add more insulation to the lid surrounding the sample holder to keep in the heat to reduce the amount of energy required to heat the samples to the correct temperature.


In this image the heat sink and fan have been isolated from the machine. These are used to keep the machine cool and running. When the cooling cycles begin the fan will increase speed to gradually decrease the temperature. Our goal was to decrease the temperature by using a more advanced heat sink and more powerful fan. The number of plates in the heat sink is abysmally small, on top of this the fan does not move air very efficiently. If the plates were both slightly smaller and the number increased with a slightly smaller gap in between the plates the amount of heat being projected into the air between the plates would be dramatically increased.
[[Image:Heat Sink and Fan Labelled.jpg|300px]] <br>
 
''This is the Heat Sink and Fan'' <br>
 
In this image the heat sink and fan have been isolated from the machine. The fan is used to keep the machine cool and running, whereas the heat sink is used to maintain the temperature of the samples during the PCR reactions. During the cooling cycles, between each temperature change, the fan will increase speed to gradually decrease the temperature of the sample holder and as a result the samples themselves.
 
Our goal was to decrease the temperature by using a more advanced heat sink and more powerful fan. The number of plates in the heat sink is abysmally small, on top of this the fan does not move air very efficiently. If the plates were both slightly smaller and the number increased with a slightly smaller gap in between the plates the amount of heat being projected into the air between the plates would be dramatically increased. With this increase of ambient heat in the machine a more powerful fan would allow for the heat to be more quickly expelled. Therefore, investing more money in a more powerful fan and a better heat sink would allow the machine to cool much more quickly and shorten the time required to run each cycle.  




'''Key Features'''<br>
'''Key Features'''<br>
Our group chose to redesign our Open PCR machine in the attempts of improving speed while maintaining, if not improving efficacy. To improve speed, we discussed several modifications including the addition of insulation of the lid of the PCR machine. This would seal in the heat generated by the lid, allowing the samples to match the temperature of the heated lid opposed to the 10 to 20 degree difference between the two. By providing insulation, there will be less escaping heat and the Open PCR machine will require less energy to maintain high temperatures (such as the initial 95 degrees celsius that the samples must be raised to).  
Our group chose to redesign our Open PCR machine in the attempts of improving speed while maintaining, if not improving efficacy. To improve speed, we discussed several modifications including the addition of insulation of the lid of the PCR machine. This would seal in the heat generated by the lid, allowing the samples to match the temperature of the heated lid opposed to the 10 to 20 degree difference between the two. By providing insulation, there will be less escaping heat and the Open PCR machine will require less energy to maintain high temperatures (such as the initial 95 degrees Celsius that the samples must be raised to).  




'''Instructions'''<br>
'''Instructions'''<br>
Step 1: Start with an original Open PCR machine such as the one design based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski
Step 1: Start with an original Open PCR machine such as the one design based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. <br>
Step 2:
Step 2: Remove the side panel from the machine; this allows access to the inside of the machine. <br>
Step 3:
Step 3: Replace the fan and heat sink with the improved version of both parts. <br>
Step 4: Replace the heating block and sample holder with the improved version of both parts.<br>
Step 5: Gently reattach the side panel back onto the Open PCR machine. <br>
Step 6: The Open PCR machine will run and operate the same as before the parts were added, just more quickly and efficiently. See the protocols section below describing normal procedures involved in operating the Open PCR machine. <br>


<!--- From Week 4 exercise --->
<!--- From Week 4 exercise --->
Line 98: Line 105:
|1 set-- Total:8
|1 set-- Total:8
|-
|-
!Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix)
!Fluorimeter and Set-Up Instructions
|1
|-
!SYBR Green Solution
|1
|-
!DNA Calf Thymus, 2 microg/ml
|1
|-
!Pre-Mixed Fluid with enzymes, cofactors, etc. (PCR Master Mix)
|10 experiments  
|10 experiments  
|-
|-
!Eye Droppers (Disposable)
!Eye Droppers (Disposable)
|10
|10
|-
!Eppendorf Tubes containing 400 mL buffer
|10
|}  
|}  


Line 119: Line 139:
|-
|-
!Power Source Access
!Power Source Access
|1
|-
!Permanent Marker
|1
|1
|-
|-
Line 126: Line 149:
!Eye Droppers (Disposable)--if needed
!Eye Droppers (Disposable)--if needed
|Extra droppers ordered online
|Extra droppers ordered online
|-
!Eppendorf tubes containing 400 mL buffer
|Extra tubes ordered online
|}  
|}  


Line 131: Line 158:
'''PCR Protocol'''
'''PCR Protocol'''


1. Gather all components for PCR reaction (template DNA, primers, Taq polymerase, magnesium chloride, and dNTP’s). <br>
1. Gather all components for PCR reaction (all located in the Pre-mixed solution provided). <br>
2. Place template DNA into a test tube. <br>
2. Place your desired template DNA into the sample test tubes in desired distribution. Label test tubes with DNA as desired <br>  
3. Add Primer 1 to the test tube. It will attach to the first binding site on one end of the template DNA.<br>
*3. Add Pre-mixed solution to test tube.<br>
4. Add Primer 2 to the test tube. It will attach to the second binding site on the opposite side of the template DNA.<br>
4. Download the Open PCR software onto the computer from online access.<br>
5. Add nucleotides (dNTP’s) to the test tube. These free floating nucleotides will be used when extending the template DNA.<br>
5. Plug the Open PCR machine power cord into an electrical outlet.<br>
6. Add Taq polymerase to the test tube. This enzyme will bind to the specific priming site and replicate DNA at the end of the strand by adding nucleotides.<br>
6. Connect the machine to the computer using the USB cable.<br>
7. Add Magnesium Chloride, a cofactor that will bind to Taq polymerase and allow for greater efficiency, to the test tube.<br>
7. Place empty PCR tubes into the machine. Close the lid and tighten the screw until it touches the tops of the tubes. Do not over-tighten!<br>
8. Download the Open PCR software onto the computer.<br>
**8. Create a new program on the machine that follows: Stage one: 1 cycle, 95 degrees Celsius for 3 minutes; Stage two: 35 cycles: 95 degrees Celsius for 30 seconds, 65 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds; Stage three: 72 degrees Celsius for 3 minutes; and a final hold at 4 degrees Celsius.<br>
9. Plug the Open PCR machine into an electrical outlet.<br>
9. Start the new program.<br>
10. Connect the machine to the computer using the USB cable.<br>
10. Wait for program to run to completion.<br>
11. Place empty PCR tubes into the machine. Close the lid and tighten the screw until it touches the tops of the tubes. Do not over-tighten!<br>
 
12. Create a new program on the machine that follows: Stage one: 1 cycle, 95 degrees Celsius for 3 minutes; Stage two: 35 cycles: 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds; Stage three: 72 degrees Celsius for 3 minutes; and a final hold at 4 degrees Celsius.<br>
----
13. Start the new program.<br>
 
14. Wait for program to run to completion.<br>
 
*The change in this procedure is in step 3 where we have substituted the general primer with the "lambda gt11 Forward" primer. <br>
This is because this "Base Stacking Tm" Calculation-- which calculates the temperature that a primer works best in-- is 65 °C ( see website: http://www.promega.com/techserv/tools/biomath/calc11.htm#melt_results and select PCR Master Mix for the salt concentration adjustment; leave the primer concentration as standard; select "lambda gt11 forward" to see all calculations). <br>
Since the "Base Stacking Tm" calculations account for many more variables in solution, it is said to be more accurate (see website again).<br>
<br>


**The above change creates our second change within the program for the PCR machine. In Stage two, the machine will cool from 95 °C to 65°C instead of 95°C to 57°C. This is an 8°C per cycle over 30 cycles, creating a 240°C difference in this step. This also creates a 7°C difference in heating back to 72°C in the third step of Stage two, creating a 210°C. Overall, this is a 450°C difference in heating and cooling temperature. Thus, the PCR reaction will increase in speed because it will save the time and energy used in cooling and reheating in stage two.
<br>
----




'''DNA Measurement Protocol'''
'''DNA Measurement Protocol'''
<br>
1. Follow the instructions included in the fluorimeter to set up your fluorimeter correctly for the DNA amplification.<br>
2. With a permanent marker label the eye droppers and Eppendorf tubes provided in accordance with the previously labeled DNA test tubes.<br>
3. Using the matching Eppendorf tubes, eye dropper, and DNA, transfer the sample into the Eppendorf tube using the eye dropper.<br>
4. Follow the instruction in the fluorimeter for placing water and the sample on the center dot. <br>
5. Follow the instruction in the fluorimeter for taking the picture and changing glass slides. SAVE ALL PICTURES TO THE CELL PHONE!<br>
6. With the permanent marker, label an eye dropper for the SYBR green solution and another for DNA Calf thymus.<br>
7. Transfer, using the specified eye dropper, 2 drops of the SYBR green solution (a green tube in the materials of the fluorimeter) like the previous samples.<br>
8. Repeat step 5, except do not add water, using for the DNA Calf thymus(a red tube in the materials of the fluorimeter.<br>
9. E-mail the pictures, one at a time, to the computer that contains Image J software.<br>
10. Save image to computer and upload into Image J.<br>
11. Analyze specimen by "drawing" a circle that outlines the droplet from the image.<br>
12. Save data in Word Excel.<br>


==Research and Development==
==Research and Development==

Latest revision as of 15:29, 29 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Doug Steinhauff (R&D Scientist)
Kaleia Kramer (Open PCR Machine Engineer)
Kathleen Farrell (Protocol and Procedures)
File:CarsonBridgers.jpg
Carson Bridgers (Open PCR Machine Engineer

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

This is the original Open PCR Machine

The originally designed Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees Celsius to create a hot-start for DNA polymerization that requires heat activation. The second step is to denature the protein, where the first cycling event heats the DNA strands at a temperature of 95 degrees Celsius for 30 seconds to melt the DNA template through the disruption of hydrogen bonding between paired bases, effectively splitting the double stranded helix into two single strands of DNA. The third step is the annealing step where the temperature is rapidly lowered to around 50 degrees Celsius to allow for the annealing of primers. The polymerase then binds to the hybrid of primers with the template to begin DNA formation. Then begins the elongation step, which differs depending on the polymerase used; typically the optimum temperature is around 75 degrees Celsius. During the elongation process, DNA polymerase synthesizes a complementary new strand of anti-parallel DNA. The amount of time required for elongation differs depending on the DNA polymerase used as well as the length of the amplified DNA fragments being used. On average, DNA polymerase amplifies at a rate of one thousand bases per minute. Next is the final elongation step where the temperature is held around 75 degrees Celsius to ensure that the DNA strand is fully elongated and will generally hold for around five minutes. Finally there is an end hold temperature that keeps the reaction at a steady temperature (between four and fifteen degrees) until the amplified DNA is ready to be utilized and further studied.

The Open PCR machine has several pros and cons. In hopes to improve efficacy and speed, our lab group has suggested several ways that the Open PCR machine can be modified to speed up the process, save energy, and provide extra insulation to prevent heat loss during the initial heating period. In addition, we also increased the size of the sample wells so that insulation, which in turn increases efficacy by distributing the heat applied to the samples in a way that requires less heat. Also, the heat sink and fan are among the least efficient components of the Open PCR machine as a whole. Thus, we intend to update both our fan and heat sink. The cooling components in between heating cycles take up the most time and doesn't cool evenly. With an updated and more advanced fan will hopefully shorten the time needed for the Open PCR system to operate. Finally, the heat sink is smaller than it needs to be. By increasing the number of plates in the heat sink and decreasing the size of each plate, there will be smaller gaps between plates, allowing the heat projected to dramatically increase. With the addition of a more efficient fan, the additional heat shouldn't cause any problems, and the summation of the changes should cut out a percentage of time required for the Open PCR machine to run.


This is the Sample Holder and Heated Lid

In this image the top has been moved aside so that the sample holder is visible separately from the heated lid itself. The sample holder keeps the samples in place while the PCR machine cycles. The heated lid tightens so that the inside of the lid will press against the samples without crushing them to ensure that they are heated quickly and evenly.

To improve this part and increase the heating rate we would widen the sample wells slightly so that insulation would be able to be placed inside them, then the whole sample block would be able to be heated without melting the plastic. This is an improvement over the current design due to the fact that it currently only heats through the lid. Heating solely through the lid is inefficient because the heated lid only comes in contact with the caps of the samples, not only is this the thickest point of the sample container, but it is also the furthest from the liquid contained in the bottom of the sample containers. By adding insulation to the sample wells we increase the heating capacity of the samples themselves as well as improving efficiency, if heat is distributed more evenly, less heat is required to allow the samples to reach the optimal temperature for each step. In addition, we wanted to add more insulation to the lid surrounding the sample holder to keep in the heat to reduce the amount of energy required to heat the samples to the correct temperature.


This is the Heat Sink and Fan

In this image the heat sink and fan have been isolated from the machine. The fan is used to keep the machine cool and running, whereas the heat sink is used to maintain the temperature of the samples during the PCR reactions. During the cooling cycles, between each temperature change, the fan will increase speed to gradually decrease the temperature of the sample holder and as a result the samples themselves.

Our goal was to decrease the temperature by using a more advanced heat sink and more powerful fan. The number of plates in the heat sink is abysmally small, on top of this the fan does not move air very efficiently. If the plates were both slightly smaller and the number increased with a slightly smaller gap in between the plates the amount of heat being projected into the air between the plates would be dramatically increased. With this increase of ambient heat in the machine a more powerful fan would allow for the heat to be more quickly expelled. Therefore, investing more money in a more powerful fan and a better heat sink would allow the machine to cool much more quickly and shorten the time required to run each cycle.


Key Features
Our group chose to redesign our Open PCR machine in the attempts of improving speed while maintaining, if not improving efficacy. To improve speed, we discussed several modifications including the addition of insulation of the lid of the PCR machine. This would seal in the heat generated by the lid, allowing the samples to match the temperature of the heated lid opposed to the 10 to 20 degree difference between the two. By providing insulation, there will be less escaping heat and the Open PCR machine will require less energy to maintain high temperatures (such as the initial 95 degrees Celsius that the samples must be raised to).


Instructions
Step 1: Start with an original Open PCR machine such as the one design based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Step 2: Remove the side panel from the machine; this allows access to the inside of the machine.
Step 3: Replace the fan and heat sink with the improved version of both parts.
Step 4: Replace the heating block and sample holder with the improved version of both parts.
Step 5: Gently reattach the side panel back onto the Open PCR machine.
Step 6: The Open PCR machine will run and operate the same as before the parts were added, just more quickly and efficiently. See the protocols section below describing normal procedures involved in operating the Open PCR machine.




Protocols

Materials

Supplied in the Kit Amount
PCR Machine 1
Programming Software Access 1--Online
USB Connector 1
Power Cord 1
Sample Tubes 1 set-- Total:8
Fluorimeter and Set-Up Instructions 1
SYBR Green Solution 1
DNA Calf Thymus, 2 microg/ml 1
Pre-Mixed Fluid with enzymes, cofactors, etc. (PCR Master Mix) 10 experiments
Eye Droppers (Disposable) 10
Eppendorf Tubes containing 400 mL buffer 10



Supplied by User Amount
DNA to Test User Discretion
Computer Access 1
Power Source Access 1
Permanent Marker 1
Pre-Mixed Fluid with enzymes, cofactors, etc. (Like GoTaq® Master Mix)--if needed Extra fluid ordered online
Eye Droppers (Disposable)--if needed Extra droppers ordered online
Eppendorf tubes containing 400 mL buffer Extra tubes ordered online


PCR Protocol

1. Gather all components for PCR reaction (all located in the Pre-mixed solution provided).
2. Place your desired template DNA into the sample test tubes in desired distribution. Label test tubes with DNA as desired

  • 3. Add Pre-mixed solution to test tube.

4. Download the Open PCR software onto the computer from online access.
5. Plug the Open PCR machine power cord into an electrical outlet.
6. Connect the machine to the computer using the USB cable.
7. Place empty PCR tubes into the machine. Close the lid and tighten the screw until it touches the tops of the tubes. Do not over-tighten!

    • 8. Create a new program on the machine that follows: Stage one: 1 cycle, 95 degrees Celsius for 3 minutes; Stage two: 35 cycles: 95 degrees Celsius for 30 seconds, 65 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds; Stage three: 72 degrees Celsius for 3 minutes; and a final hold at 4 degrees Celsius.

9. Start the new program.
10. Wait for program to run to completion.



  • The change in this procedure is in step 3 where we have substituted the general primer with the "lambda gt11 Forward" primer.

This is because this "Base Stacking Tm" Calculation-- which calculates the temperature that a primer works best in-- is 65 °C ( see website: http://www.promega.com/techserv/tools/biomath/calc11.htm#melt_results and select PCR Master Mix for the salt concentration adjustment; leave the primer concentration as standard; select "lambda gt11 forward" to see all calculations).
Since the "Base Stacking Tm" calculations account for many more variables in solution, it is said to be more accurate (see website again).

    • The above change creates our second change within the program for the PCR machine. In Stage two, the machine will cool from 95 °C to 65°C instead of 95°C to 57°C. This is an 8°C per cycle over 30 cycles, creating a 240°C difference in this step. This also creates a 7°C difference in heating back to 72°C in the third step of Stage two, creating a 210°C. Overall, this is a 450°C difference in heating and cooling temperature. Thus, the PCR reaction will increase in speed because it will save the time and energy used in cooling and reheating in stage two.




DNA Measurement Protocol
1. Follow the instructions included in the fluorimeter to set up your fluorimeter correctly for the DNA amplification.
2. With a permanent marker label the eye droppers and Eppendorf tubes provided in accordance with the previously labeled DNA test tubes.
3. Using the matching Eppendorf tubes, eye dropper, and DNA, transfer the sample into the Eppendorf tube using the eye dropper.
4. Follow the instruction in the fluorimeter for placing water and the sample on the center dot.
5. Follow the instruction in the fluorimeter for taking the picture and changing glass slides. SAVE ALL PICTURES TO THE CELL PHONE!
6. With the permanent marker, label an eye dropper for the SYBR green solution and another for DNA Calf thymus.
7. Transfer, using the specified eye dropper, 2 drops of the SYBR green solution (a green tube in the materials of the fluorimeter) like the previous samples.
8. Repeat step 5, except do not add water, using for the DNA Calf thymus(a red tube in the materials of the fluorimeter.
9. E-mail the pictures, one at a time, to the computer that contains Image J software.
10. Save image to computer and upload into Image J.
11. Analyze specimen by "drawing" a circle that outlines the droplet from the image.
12. Save data in Word Excel.

Research and Development

Background on Disease Markers

Alzheimer’s disease is the slow deterioration of the brain. There is no known cure for this disease and it eventually results in death. This disease usually begins with the inability to remember things that have recently happened and in the late stages patients will have much difficulty in remembering basic cognitive functions. The specific missense mutation that I am examining changes a Thymine to a Guanine on the ninth chromosome. This mutation has a 3.8 times increased risk for an early onset of Alzheimer’s. The data reference number is Rs908832. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=908832

Cystic Fibrosis is caused by a mutation of the protein cystic fibrosis transmembrane conductance regulator. This protein regulates the movement of chloride and sodium ions. Symptoms include slow growth, accumulation of mucus, chest infections, coughing, and shortness of breath. The average patient will be able to live 37 years. The specific mutation I am looking at is a deletion of three nucleotides on the seventh chromosome and causes the deletion of phenylalanine from the polypeptide. In 1979 about 70% of all cystic fibrosis patients carried this mutation. The data reference number is rs113993960. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=113993960



Primer Design

When testing the Alzheimer’s mutation the forward primer will be TGGCTCCACCACCTCGTGCCC and the reverse primer will be TTTGTGGGGCACGAGGTGGTG. When testing for the cystic fibrosis mutation the forward primer will be TCTTTTATAGTAACCACAAA and the reverse primer will be AACACCAAAGATATTTTCTT.


Illustration

The following illustration is an example of how the primers for Alzheimer's disease would be able to bind to the template strand. Then the TAQ Polymerase would be able to amplify the DNA and result in a positive PCR reaction. The red shows the location of the SNP.

The following illustration shows how a primer would not be able to bind to the mutation resulting in Cystic Fibrosis as it still contains the three nucleotides that would be deleted if their was a mutation present. Since the primer is designed for the mutated DNA the primer is not able to bond to the normal DNA, which results in zero amplification and a negative PCR result. The red parts show which three DNA nucleotides should be deleted due to the SNP.