BME103:T930 Group 2 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(31 intermediate revisions by 5 users not shown)
Line 1: Line 1:
{|{{table}} width="800"
{|{{table}} width="800"
|-
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> BME 103 Fall 2012</span>
|style="background-color: #99FF99"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> BME 103 Fall 2012</span>
|style="background-color: #F2F2F2" | [[BME103 | <font face="trebuchet ms" style="color: #808080"> '''Home''' </font>]]<br>[[BME103:People | <font face="trebuchet ms" style="color: #808080"> '''People''' </font>]]<br>[[BME103:Projects | <font face="trebuchet ms" style="color: #808080"> '''Lab Write-Up 1''' </font>]]<br>[[BME103:Projects2 | <font face="trebuchet ms" style="color: #808080"> '''Lab Write-Up 2''' </font>]]<br>[[BME103:Projects3 | <font face="trebuchet ms" style="color: #808080"> '''Lab Write-Up 3''' </font>]]<br>[[BME103:Logistics | <font face="trebuchet ms" style="color: #808080"> ''' Course Logistics For Instructors''' </font>]] <br>[[BME103:Photos | <font face="trebuchet ms" style="color: #808080"> '''Photos''' </font>]] <br>[[BME103:WikiHelp | <font face="trebuchet ms" style="color: #808080"> '''Wiki Editing Help''' </font>]]  
|style="background-color: #99FFCC" | [[BME103 | <font face="trebuchet ms" style="color: #808080"> '''Home''' </font>]]<br>[[BME103:People | <font face="trebuchet ms" style="color: #808080"> '''People''' </font>]]<br>[[BME103:Projects | <font face="trebuchet ms" style="color: #808080"> '''Lab Write-Up 1''' </font>]]<br>[[BME103:Projects2 | <font face="trebuchet ms" style="color: #808080"> '''Lab Write-Up 2''' </font>]]<br>[[BME103:Projects3 | <font face="trebuchet ms" style="color: #808080"> '''Lab Write-Up 3''' </font>]]<br>[[BME103:Logistics | <font face="trebuchet ms" style="color: #808080"> ''' Course Logistics For Instructors''' </font>]] <br>[[BME103:Photos | <font face="trebuchet ms" style="color: #808080"> '''Photos''' </font>]] <br>[[BME103:WikiHelp | <font face="trebuchet ms" style="color: #808080"> '''Wiki Editing Help''' </font>]]  
|-
|-
| style="background-color: #ffcc66; padding: 5px;" colspan="2" | [[Image:BME494_Asu_logo.png]]
| style="background-color: #FFFFFF; padding: 5px;" colspan="2" | [[Image:BME494_Asu_logo.png]]
|-
|-
| colspan="2"|
| colspan="2"|
Line 24: Line 24:


==Thermal Cycler Engineering==
==Thermal Cycler Engineering==
 
[[Image:BME103_Group2_PCRChanges.jpg|750px|]] <br>
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br>
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br>




'''System Design'''<br>
'''System Design'''<br>
 
Our new and improved PCR Machine encompasses a redesign where we improved the inner materials of the machine. By doing so, we can decrease the time it takes to duplicate the DNA samples, thanks to the new material, which is more insulating and responds more quickly to heat changes. Now, the PCR can be more effective and produce more samples in a given span of time. The modified PCR will also feature a larger capacity tube block. This will also make better efficiency and use of time. With the new tube block more tubes samples will be duplicated during a single run of the PCR. Finally, better quality wires and wire harness will be implemented in the new design. This is to facilitate the assembly and disassembly of the PCR, due to the previous version having very tight and hard to work with wiring.




'''Key Features'''<br>
'''Key Features'''<br>
 
In addition, we made a change in the top lid of the Open PCR. We made one of the sides transparent to facilitate the tightening of the samples when they are placed in the rack. This way, one can easily see through the transparent side to check when the plate is secured on top of the sample lids. This will eliminate the possibility of over tightening which can damage the tubes and samples. Also, the new design will feature a side panel that is on a hinge. This is to make easier the access to the internal parts of the machine. The previous version had screws connecting the panels that were near impossible to work with. Finally, The other side panel will have a clip similar to that of a vaccum cleaner in which one can wind a long cord around. This makes is possible to have a longer power cord on the PCR machine.




'''Instructions'''<br>
'''Instructions'''<br>
 
The instructions for use of the updated PCR are similar to the first. The larger tube block requires no further instructions. Also, the transparent side of the lid doesn't change any of the istructions, but rather makes the step of tightening the lid screw more simple. Similarly, having the higher quality wire harness makes no changes, but makes any instructions on disassemby and assembly much more simple. Finally the cord clip has the simnple instructions of winding a cord. Again, the addition of the hinged side panel does not add any new special instructions. <br>
 
[[Image:BME103_Group2_PCRsoftware.jpg|200px|]]<br>
The main focus of the PCR is to be simple to use and have an easy, user-friendly interface. Our goal was to not to over complicate the system, but rather improve it. For that reason we have kept such instructions as the software interface and cycling the same.
<!--- From Week 4 exercise --->
<!--- From Week 4 exercise --->


Line 60: Line 61:
'''Materials'''
'''Materials'''


{| border="1" style="border-collapse:collapse;" style="margin: 1em auto 1em auto;"
{| border="1" style="border-collapse:collapse;" style="margin: 1em auto 1em auto;"
|-
|-
! Supplied in the Kit !! Amount
! Supplied in the Kit !! Amount
Line 74: Line 75:
| dH<sub>2</sub>O || 764.8 μL
| dH<sub>2</sub>O || 764.8 μL
|-
|-
|Tubes || 16
|Eppendorf Tubes || 16
|-
|-
|Fluorimeter || 1
|Fluorimeter || 1
|-
|-
|Teflon Glass Slides || 16
|Teflon Glass Slides || 16
|-
|Allen Wrench  || 1
|-
|Operations Manual  || 1
|}
|}


{| border="1" style="border-collapse:collapse;" style="margin: 1em auto 1em auto;"
|-
! Supplied by User !! Amount
|-
| Screwdriver || 1
|-
| Template DNA (20ng)  || 3.2 μL
|-
| Micro-Pipetter || 16
|-
| Camera Phone || 1
|}




'''PCR Protocol'''
'''PCR Protocol'''


1. Gather materials and assemble as shown in apparatus/manual <br>
2. Label provided tubes with a number to indicate its sample.<br>
4. With the micropipette, place the forward/reverse primer into the indicated tube. <br>
5. Use a clean micropipette to place the master mix into the DNA/primer mixture in the tubes.<Br>
6. Transfer the 16 Eppendorf tubes containing DNA and Mix into the Open PCR Machine. <br>
7. Open PCR program and input the number of cycles: 30. <br>
8. Set the temperature and times into the program.<br>
- Denaturing temperature to 95°C. Time to 30 seconds.<br>
-Annealing temperature to 57°C. Time to 30 seconds.<br>
-Extending temperature to 72°C. Time to 30 seconds.<br>
9. Close lid to commence process.<br>
10. Start program.<br>
11. When PCR is complete, ensue to the DNA Measurement Protocol shown below.






'''DNA Measurement Protocol'''
'''DNA Measurement Protocol'''
1. Create 8 DNA template samples that will be the focus of the investigation and place them in the PCR Machine allowing them to complete the process and replicate.
2. Transfer each sample independently into its designated Eppendorf Tube with the 400mL buffer completely. Ensure that a single pipette is used per sample.
3. After setting up the fluorimeter, place 2 drops of SYBR Green onto the teflon slide followed by 2 drops of the sample you wish to use. (Again use the same pipette used to transfer the sample)
4. Align up the drop so the light is passing through it.
5. Take pictures of the drop using a camera or smartphone, these will later be uploaded to ImageJ for analysis.
6. Each slide is capable of handling 5 individual samples so simply place the drops in an empty space and repeat the process.
7. Also run drops from the scintillation vial as blanks using the same process.
8. Upload the pictures taken into Image J.
9. To analyze the images subtract the INTDEN measurement form the background from the INTDEN measurement form the drop and repeat for all trials.


==Research and Development==
==Research and Development==
Line 96: Line 144:


'''Background on Disease Markers'''
'''Background on Disease Markers'''
* Sample A


<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
[[Sickle Cell Anemia]]


''rs35685286 [Homo sapiens]''


GGATGAAGTTGGTGGT--GAGGCCCTGG[A/G]CAGGTTGGTA--TCAAGGTTACAAGAC
Chromosome 11- single nucleotide variation
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286
* Sample B
[[Sickle Cell Anemia]]
''rs34430836 [Homo sapiens]''
AGGTGCTAGGTGCCTT--TAGTGATGGC[C/G]TGGCTCACCT--GGACAACCTCAAGGG
Chromosome 11- single nucleotide variation
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=34430836
''Disease Description''
Sickle cell anemia is an inherited blood disorder characterized primarily by chronic anemia and periodic episodes of pain. The underlying problem involves hemoglobin, a component of red blood cells. Hemoglobin molecules in each red blood cell carry oxygen from the lungs to body organs and tissues and bring carbon dioxide back to the lungs.
In sickle cell anemia, the hemoglobin is defective. After hemoglobin molecules give up their oxygen, some may cluster together and form long, rod-like structures. These structures cause red blood cells to become stiff and assume a sickle shape.
Unlike normal red cells, which are usually smooth and donut-shaped, sickled red cells cannot squeeze through small blood vessels. Instead, they stack up and cause blockages that deprive organs and tissues of oxygen-carrying blood. This process produces periodic episodes of pain and ultimately can damage tissues and vital organs and lead to other serious medical problems. Normal red blood cells live about 120 days in the bloodstream, but sickled red cells die after about 10 to 20 days. Because they cannot be replaced fast enough, the blood is chronically short of red blood cells, a condition called anemia.
''Inheritance''
Sickle cell anemia is an autosomal recessive genetic disorder caused by a defect in the HBB gene, which codes for hemoglobin. The presence of two defective genes (SS) is needed for sickle cell anemia. If each parent carries one sickle hemoglobin gene (S) and one normal gene (A), each child has a 25% chance of inheriting two defective genes and having sickle cell anemia; a 25% chance of inheriting two normal genes and not having the disease; and a 50% chance of being an unaffected carrier like the parents.
Source: http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/sca.shtml




'''Primer Design'''
'''Primer Design'''


<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
* Sample A
 
''rs35685286 [Homo sapiens]''
 
Primer--CTCCGGGACCTGTCCAACCAT
 
Reverse Primer-- GAGGCCCTGGACAGGTTGGTA
 
 
 
* Sample B
 
''rs34430836 [Homo sapiens]''


Primer--ATCACTACCGGACCGAGTGGA


Reverse Primer--TAGTGATGGCCTGGCTCACCT




'''Illustration'''
'''Illustration'''


<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
* Sample A
This image illustrates the primer attaching to the reverse primer. The primer that is created attaches to the section of DNA that is mutated and is then able to be replicated with PCR, because it will allow the Taq polymerase to begin attaching nucleotides.
 
[[Image:Primer sickle 1.jpg|600px|]]
 
* Sample B
This image illustrates the primer attaching to the reverse primer. The primer that is created attaches to the section of DNA that is mutated and is then able to be replicated with PCR, because it will allow the Taq polymerase to begin attaching nucleotides.
 
[[Image:Primer sickle 2.jpg|600px|]]
 
'''Bayesian Information'''
* Sample A
 
Affected Gene: HBB  hemoglobin, beta
 
Population Diversity: About 250 million people, and about 300,000 infants are born with a major hemoglobinopathies every year
 
Probability of having mutation: 4.5%- of the world population
 
[Source: Angastiniotis M, Modell B, Englezos P, Boulyzhenkov V. Prevention and control of hemoglobinopathies. Bull World Health Organ. 1995; 73: 375-386. - See more at: http://www.ispub.com/journal/the-internet-journal-of-biological-anthropology/volume-1-number-2/epidemiology-population-health-genetics-and-phenotypic-diversity-of-sickle-cell-disease-in-india.html#e-44]
 
* Sample B
 
Affected Gene: HBD  hemoglobin, delta
 
Population Diversity: About 250 million people, and about 300,000 infants are born with a major hemoglobinopathies every year


Probability of having mutation: 4.5%- of the world population


[Source: Angastiniotis M, Modell B, Englezos P, Boulyzhenkov V. Prevention and control of hemoglobinopathies. Bull World Health Organ. 1995; 73: 375-386. - See more at: http://www.ispub.com/journal/the-internet-journal-of-biological-anthropology/volume-1-number-2/epidemiology-population-health-genetics-and-phenotypic-diversity-of-sickle-cell-disease-in-india.html#e-44]
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Latest revision as of 16:28, 29 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Ryan Sullivan
Research Development Scientist
Miriam Y Acosta
PCR Machine Engineer
Ryan Keeney
PCR Machine Engineer
Juliana Ramos
Experimental Protocol Planner
Aaron Cornejo
Experimental Protocol Planner

LAB 2 WRITE-UP

Thermal Cycler Engineering


Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
Our new and improved PCR Machine encompasses a redesign where we improved the inner materials of the machine. By doing so, we can decrease the time it takes to duplicate the DNA samples, thanks to the new material, which is more insulating and responds more quickly to heat changes. Now, the PCR can be more effective and produce more samples in a given span of time. The modified PCR will also feature a larger capacity tube block. This will also make better efficiency and use of time. With the new tube block more tubes samples will be duplicated during a single run of the PCR. Finally, better quality wires and wire harness will be implemented in the new design. This is to facilitate the assembly and disassembly of the PCR, due to the previous version having very tight and hard to work with wiring.


Key Features
In addition, we made a change in the top lid of the Open PCR. We made one of the sides transparent to facilitate the tightening of the samples when they are placed in the rack. This way, one can easily see through the transparent side to check when the plate is secured on top of the sample lids. This will eliminate the possibility of over tightening which can damage the tubes and samples. Also, the new design will feature a side panel that is on a hinge. This is to make easier the access to the internal parts of the machine. The previous version had screws connecting the panels that were near impossible to work with. Finally, The other side panel will have a clip similar to that of a vaccum cleaner in which one can wind a long cord around. This makes is possible to have a longer power cord on the PCR machine.


Instructions
The instructions for use of the updated PCR are similar to the first. The larger tube block requires no further instructions. Also, the transparent side of the lid doesn't change any of the istructions, but rather makes the step of tightening the lid screw more simple. Similarly, having the higher quality wire harness makes no changes, but makes any instructions on disassemby and assembly much more simple. Finally the cord clip has the simnple instructions of winding a cord. Again, the addition of the hinged side panel does not add any new special instructions.

The main focus of the PCR is to be simple to use and have an easy, user-friendly interface. Our goal was to not to over complicate the system, but rather improve it. For that reason we have kept such instructions as the software interface and cycling the same.




Protocols

Materials

Supplied in the Kit Amount
Open PCR Machine 1
10 μM Forward Primer 16.0 μL
10 μM Reverse Primer 16.0 μL
GoTaq Master Mix 800.0 μL
dH2O 764.8 μL
Eppendorf Tubes 16
Fluorimeter 1
Teflon Glass Slides 16
Allen Wrench 1
Operations Manual 1
Supplied by User Amount
Screwdriver 1
Template DNA (20ng) 3.2 μL
Micro-Pipetter 16
Camera Phone 1


PCR Protocol

1. Gather materials and assemble as shown in apparatus/manual
2. Label provided tubes with a number to indicate its sample.
4. With the micropipette, place the forward/reverse primer into the indicated tube.
5. Use a clean micropipette to place the master mix into the DNA/primer mixture in the tubes.
6. Transfer the 16 Eppendorf tubes containing DNA and Mix into the Open PCR Machine.
7. Open PCR program and input the number of cycles: 30.
8. Set the temperature and times into the program.
- Denaturing temperature to 95°C. Time to 30 seconds.
-Annealing temperature to 57°C. Time to 30 seconds.
-Extending temperature to 72°C. Time to 30 seconds.
9. Close lid to commence process.
10. Start program.
11. When PCR is complete, ensue to the DNA Measurement Protocol shown below.


DNA Measurement Protocol

1. Create 8 DNA template samples that will be the focus of the investigation and place them in the PCR Machine allowing them to complete the process and replicate.

2. Transfer each sample independently into its designated Eppendorf Tube with the 400mL buffer completely. Ensure that a single pipette is used per sample.

3. After setting up the fluorimeter, place 2 drops of SYBR Green onto the teflon slide followed by 2 drops of the sample you wish to use. (Again use the same pipette used to transfer the sample)

4. Align up the drop so the light is passing through it.

5. Take pictures of the drop using a camera or smartphone, these will later be uploaded to ImageJ for analysis.

6. Each slide is capable of handling 5 individual samples so simply place the drops in an empty space and repeat the process.

7. Also run drops from the scintillation vial as blanks using the same process.

8. Upload the pictures taken into Image J.

9. To analyze the images subtract the INTDEN measurement form the background from the INTDEN measurement form the drop and repeat for all trials.

Research and Development

Background on Disease Markers

  • Sample A

Sickle Cell Anemia

rs35685286 [Homo sapiens]

GGATGAAGTTGGTGGT--GAGGCCCTGG[A/G]CAGGTTGGTA--TCAAGGTTACAAGAC

Chromosome 11- single nucleotide variation

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286


  • Sample B

Sickle Cell Anemia

rs34430836 [Homo sapiens]

AGGTGCTAGGTGCCTT--TAGTGATGGC[C/G]TGGCTCACCT--GGACAACCTCAAGGG

Chromosome 11- single nucleotide variation

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=34430836


Disease Description

Sickle cell anemia is an inherited blood disorder characterized primarily by chronic anemia and periodic episodes of pain. The underlying problem involves hemoglobin, a component of red blood cells. Hemoglobin molecules in each red blood cell carry oxygen from the lungs to body organs and tissues and bring carbon dioxide back to the lungs.

In sickle cell anemia, the hemoglobin is defective. After hemoglobin molecules give up their oxygen, some may cluster together and form long, rod-like structures. These structures cause red blood cells to become stiff and assume a sickle shape.

Unlike normal red cells, which are usually smooth and donut-shaped, sickled red cells cannot squeeze through small blood vessels. Instead, they stack up and cause blockages that deprive organs and tissues of oxygen-carrying blood. This process produces periodic episodes of pain and ultimately can damage tissues and vital organs and lead to other serious medical problems. Normal red blood cells live about 120 days in the bloodstream, but sickled red cells die after about 10 to 20 days. Because they cannot be replaced fast enough, the blood is chronically short of red blood cells, a condition called anemia.


Inheritance

Sickle cell anemia is an autosomal recessive genetic disorder caused by a defect in the HBB gene, which codes for hemoglobin. The presence of two defective genes (SS) is needed for sickle cell anemia. If each parent carries one sickle hemoglobin gene (S) and one normal gene (A), each child has a 25% chance of inheriting two defective genes and having sickle cell anemia; a 25% chance of inheriting two normal genes and not having the disease; and a 50% chance of being an unaffected carrier like the parents.

Source: http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/sca.shtml


Primer Design

  • Sample A

rs35685286 [Homo sapiens]

Primer--CTCCGGGACCTGTCCAACCAT

Reverse Primer-- GAGGCCCTGGACAGGTTGGTA


  • Sample B

rs34430836 [Homo sapiens]

Primer--ATCACTACCGGACCGAGTGGA

Reverse Primer--TAGTGATGGCCTGGCTCACCT


Illustration

  • Sample A

This image illustrates the primer attaching to the reverse primer. The primer that is created attaches to the section of DNA that is mutated and is then able to be replicated with PCR, because it will allow the Taq polymerase to begin attaching nucleotides.

  • Sample B

This image illustrates the primer attaching to the reverse primer. The primer that is created attaches to the section of DNA that is mutated and is then able to be replicated with PCR, because it will allow the Taq polymerase to begin attaching nucleotides.

Bayesian Information

  • Sample A

Affected Gene: HBB hemoglobin, beta

Population Diversity: About 250 million people, and about 300,000 infants are born with a major hemoglobinopathies every year

Probability of having mutation: 4.5%- of the world population

[Source: Angastiniotis M, Modell B, Englezos P, Boulyzhenkov V. Prevention and control of hemoglobinopathies. Bull World Health Organ. 1995; 73: 375-386. - See more at: http://www.ispub.com/journal/the-internet-journal-of-biological-anthropology/volume-1-number-2/epidemiology-population-health-genetics-and-phenotypic-diversity-of-sickle-cell-disease-in-india.html#e-44]

  • Sample B

Affected Gene: HBD hemoglobin, delta

Population Diversity: About 250 million people, and about 300,000 infants are born with a major hemoglobinopathies every year

Probability of having mutation: 4.5%- of the world population

[Source: Angastiniotis M, Modell B, Englezos P, Boulyzhenkov V. Prevention and control of hemoglobinopathies. Bull World Health Organ. 1995; 73: 375-386. - See more at: http://www.ispub.com/journal/the-internet-journal-of-biological-anthropology/volume-1-number-2/epidemiology-population-health-genetics-and-phenotypic-diversity-of-sickle-cell-disease-in-india.html#e-44]