BME103:T930 Group 3 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(37 intermediate revisions by 5 users not shown)
Line 14: Line 14:
|- valign="top"
|- valign="top"
| [[Image:Peacock feather.jpg|100px|thumb|Name: Lekha Anantuni <br>Role: R&D]]
| [[Image:Peacock feather.jpg|100px|thumb|Name: Lekha Anantuni <br>Role: R&D]]
| [[Image:BME103student.jpg|100px|thumb|Name: Rohan Kumar <br>Role(s)]]
| [[Image:Ted.jpg|100px|thumb|Name: Rohan Kumar <br>Experimental protocol planner]]
| [[Image:BME103student.jpg|100px|thumb|Name: Kyle Stoneking <br>Role(s)]]
| [[Image:Stewie.jpg|100px|thumb|Name: Kyle Stoneking <br>Experimental protocol planner]]
| [[Image:BME103student.jpg|100px|thumb|Name: Austin Cuaderno <br>Role(s)]]
| [[Image:7020-ukf-dubstep.png|100px|thumb|Name: Austin Cuaderno <br>Open PCR machine engineer]]
| [[Image:BME103student.jpg|100px|thumb|Name: Josh Eger <br>Role(s)]]
| [[Image:Elmo.jpg|100px|thumb|Name: Josh Eger <br>Open PCR machine engineer]]
|}
|}


Line 24: Line 24:


==Thermal Cycler Engineering==
==Thermal Cycler Engineering==
 
<br>
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br>
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br>


Line 30: Line 30:
'''System Design'''<br>
'''System Design'''<br>


[[Image:BME103 Group3 PCR.jpg|300px|]]<br>
[[Image:BME103.Group3.Rechargeable Battery.PNG|400px|]]
[[Image:BME103.Group3.45454544543221.Wifi BlueTooth.PNG|400px|]]


<br>


'''Key Features'''<br>
'''Key Features'''<br>
The main features that we improved on this design of the Open PCR compared to the previous model was the portability and ease of use. The old Open PCR required a power cord that needed to be plugged into the wall at all times during use. The new design eliminates that inconvenience as it runs on a rechargable battery. It can be cumbersome to find a power outlet, but now the Open PCR can be used in more convenient places.


The old PCR also required a USB cable in order to send information to the computer and receive the input information on the program. The updated Open PCR is easier to connect to the computer since it does not need to be plugged in directly to the computer but instead connects via bluetooth. These two updates make the Open PCR portable and completely wireless. It is more convenient and easy to use compared to the old design of the PCR.


We additionally made our new design of the Open PCR aesthetically pleasing, so it will be available in bright and exciting colors such as red, green and purple.


'''Instructions'''<br>
'''Instructions'''<br>
1) Plug in the PCR machine. <br>
2) Turn on bluetooth on machine and phone. <br>
3) Pair the devices to share the data collected. <br>
4) Turn on wifi on the Computer. <br>
5) Load the open PCR machine with samples to test. <br>
6) Click "Run Test" on phone. <br>
7) Wait for machine to finish running. <br>
8) Test results with the Fluorometer. <br>
<!--- From Week 4 exercise --->




<!--- From Week 4 exercise --->
<br>
 
 
<br><br>


==Protocols==
==Protocols==
 
<br>
<!--- Design a new protocol based on your group's new PCR design. Make a step-by-step list of how someone should use your method
<!--- Design a new protocol based on your group's new PCR design. Make a step-by-step list of how someone should use your method
Things to consider:
Things to consider:
Line 69: Line 82:
| Template DNA (20 ng) || 0.2 μL  
| Template DNA (20 ng) || 0.2 μL  
|-
|-
| 10 μM forward primer ||1.0 μL
| Fluorimeter ||1
|-
| Open PCR Software || 1
|-
| Image J Software || 1
|-
| Glass Slides  || 50
|-
|} <br>
 
{| class="wikitable" border="1 px"
|-
! Supplied by User !! Amount
|-
| Pippets || 8
|-
| Computer || 1
|-
| 10 μM reverse primer || 1.0 μL
|-
|-
| 10 μM reverse primer || 1.0 μL
| 10 μM reverse primer || 1.0 μL
Line 77: Line 108:
| dH<sub>2</sub>O || 47.8 μL
| dH<sub>2</sub>O || 47.8 μL
|-
|-
| <strong>Total Volume</strong> || 100.0 μL
|Eppendrof tubes || 10
|-
|}
|}
<br>


'''PCR Protocol'''
'''PCR Protocol'''<br>
 
-Turn on PCR make sure it is fully charged, connect it to your computer using bluetooth or WiFi signal.<br> 
1.)Get 3 replicate DNA samples each from two patients and one positive control and negative control sample for a total of 8 samples. Mix each of your samples with Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample should be about 50 micro liters.<br>
2.)Label 8 empty PCR tube with unique labels that correspond to their respective DNA samples.<br> 
3.)Using one pipette per sample, to avoid contamination, transfer the PCR reaction mix to PCR tubes.<br>
4.)Then place the samples into the PCR machine.<br>
5.)Set the PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius.<br>






'''DNA Measurement Protocol'''
'''DNA Measurement Protocol'''<br>
1.) After your PCR has finished replication, take the samples to the fluorimeter. Using permanent marker, number the transfer pipette at the bulb, so its only used for a single sample.<br>
2.)With the permanent marker label the Eppendrof tubes at the top, you should have a total of 10 Eppendrof tubes labeled and 10 pipettes labeled.<br>
3.)Transfer each sample separately into the Eppendorf tubes containing 400 ml of buffer.<br>
4.)Using a specially labeled Eppendorf tube containing SYBR GREEN, with its own pippter, place two drops onto the first two center drops.<br>
5.)Then using the sample place two drops on top of the SYBR GREEN solution drops.<br>
6.)Then align the blue light of the fluorimeter so it passes through the drop.<br>
7.)Then the smartphone operator should take a picture with the settings on the phone adjusted to inactive flash, iso to 800, white balance to auto, exposure to the highest setting and contrast to the lowest setting.<br>
8.)This process should be repeated for all samples.<br>
9.)Now analyze your pictures with Image J software.<br>
10.)Open the software. Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value.<br> 11.)Using the menu select image > color > split channels.<br>
12.) This should have created 3 files: a red, green and blue image. You only need the green image.<br>
13.) Now click the menu bar to activate the oval selection.<br>
14.) Draw an oval around the image of your sample and then select analyze > measure.<br>
15.) Now move the previously drawn oval to an area away from the sample to obtain the noise measurements.<br>
16.) Repeat this process for all of your samples, including the controls. <br>
<br>


==Research and Development==
==Research and Development==
Line 95: Line 149:


<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
1.) The amyloid Beta precursor protein for Alzheimer's - <br>
1.) The amyloid Beta precursor protein for Alzheimer's - Alzheimer's disease is a form of dementia in which patients experience loss of memory , confusion, as well as other symptoms. The amyloid hypothesis states that Alzheimer's is caused by a buildup of the amyloid protein in the brain. This gene for amyloid Beta precursor protein therefore might reveal to doctors and scientist whether or not an individual will develop Alzheimer's. <br>
rs63751263 (http://omim.org/entry/104760#0008) <br>
rs63751263 (http://omim.org/entry/104760#0008) <br>
AGACGGAGGAGATCTCTGAAGTGAAG ''[A/C]'' TGGATGCAGAATTCCGACATGACTC <br><br>
AGACGGAGGAGATCTCTGAAGTGAAG ''[A/C]'' TGGATGCAGAATTCCGACATGACTC <br><br>


2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - <br>
2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - Spinal muscular atrophy is a disease caused by a genetic mutation in the SMN1 gene. Individuals that have this disease exhibit various degrees of mobility impairment due to the widespread death of motor neurons. <br>
rs80356547(http://omim.org/entry/314370#0002) <br>
rs80356547(http://omim.org/entry/314370#0002) <br>
GATGGCGTGGCCAATGCCCTGGACAA ''[C/T]'' GTCCATGCCCGTCAGTTTGGAGGCG <br><br>
GATGGCGTGGCCAATGCCCTGGACAA ''[C/T]'' GTCCATGCCCGTCAGTTTGGAGGCG <br><br>
Line 117: Line 171:
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
[[Image:DNA Amplification.jpg|200px|Exponential amplification of a specific gene.]]<br>
[[Image:DNA Amplification.jpg|200px|Exponential amplification of a specific gene.]]<br>
 
<br>


<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Latest revision as of 20:56, 29 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Lekha Anantuni
Role: R&D
Name: Rohan Kumar
Experimental protocol planner
Name: Kyle Stoneking
Experimental protocol planner
Name: Austin Cuaderno
Open PCR machine engineer
Name: Josh Eger
Open PCR machine engineer

LAB 2 WRITE-UP

Thermal Cycler Engineering


Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design



Key Features
The main features that we improved on this design of the Open PCR compared to the previous model was the portability and ease of use. The old Open PCR required a power cord that needed to be plugged into the wall at all times during use. The new design eliminates that inconvenience as it runs on a rechargable battery. It can be cumbersome to find a power outlet, but now the Open PCR can be used in more convenient places.

The old PCR also required a USB cable in order to send information to the computer and receive the input information on the program. The updated Open PCR is easier to connect to the computer since it does not need to be plugged in directly to the computer but instead connects via bluetooth. These two updates make the Open PCR portable and completely wireless. It is more convenient and easy to use compared to the old design of the PCR.

We additionally made our new design of the Open PCR aesthetically pleasing, so it will be available in bright and exciting colors such as red, green and purple.

Instructions
1) Plug in the PCR machine.
2) Turn on bluetooth on machine and phone.
3) Pair the devices to share the data collected.
4) Turn on wifi on the Computer.
5) Load the open PCR machine with samples to test.
6) Click "Run Test" on phone.
7) Wait for machine to finish running.
8) Test results with the Fluorometer.



Protocols


Materials

Supplied in the kit Amount
Open PCR Machine 1
Template DNA (20 ng) 0.2 μL
Fluorimeter 1
Open PCR Software 1
Image J Software 1
Glass Slides 50

Supplied by User Amount
Pippets 8
Computer 1
10 μM reverse primer 1.0 μL
10 μM reverse primer 1.0 μL
GoTaq master mix 50.0 μL
dH2O 47.8 μL
Eppendrof tubes 10


PCR Protocol
-Turn on PCR make sure it is fully charged, connect it to your computer using bluetooth or WiFi signal.
1.)Get 3 replicate DNA samples each from two patients and one positive control and negative control sample for a total of 8 samples. Mix each of your samples with Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample should be about 50 micro liters.
2.)Label 8 empty PCR tube with unique labels that correspond to their respective DNA samples.
3.)Using one pipette per sample, to avoid contamination, transfer the PCR reaction mix to PCR tubes.
4.)Then place the samples into the PCR machine.
5.)Set the PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius.


DNA Measurement Protocol
1.) After your PCR has finished replication, take the samples to the fluorimeter. Using permanent marker, number the transfer pipette at the bulb, so its only used for a single sample.
2.)With the permanent marker label the Eppendrof tubes at the top, you should have a total of 10 Eppendrof tubes labeled and 10 pipettes labeled.
3.)Transfer each sample separately into the Eppendorf tubes containing 400 ml of buffer.
4.)Using a specially labeled Eppendorf tube containing SYBR GREEN, with its own pippter, place two drops onto the first two center drops.
5.)Then using the sample place two drops on top of the SYBR GREEN solution drops.
6.)Then align the blue light of the fluorimeter so it passes through the drop.
7.)Then the smartphone operator should take a picture with the settings on the phone adjusted to inactive flash, iso to 800, white balance to auto, exposure to the highest setting and contrast to the lowest setting.
8.)This process should be repeated for all samples.
9.)Now analyze your pictures with Image J software.
10.)Open the software. Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value.
11.)Using the menu select image > color > split channels.
12.) This should have created 3 files: a red, green and blue image. You only need the green image.
13.) Now click the menu bar to activate the oval selection.
14.) Draw an oval around the image of your sample and then select analyze > measure.
15.) Now move the previously drawn oval to an area away from the sample to obtain the noise measurements.
16.) Repeat this process for all of your samples, including the controls.

Research and Development

Background on Disease Markers

1.) The amyloid Beta precursor protein for Alzheimer's - Alzheimer's disease is a form of dementia in which patients experience loss of memory , confusion, as well as other symptoms. The amyloid hypothesis states that Alzheimer's is caused by a buildup of the amyloid protein in the brain. This gene for amyloid Beta precursor protein therefore might reveal to doctors and scientist whether or not an individual will develop Alzheimer's.
rs63751263 (http://omim.org/entry/104760#0008)
AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC

2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - Spinal muscular atrophy is a disease caused by a genetic mutation in the SMN1 gene. Individuals that have this disease exhibit various degrees of mobility impairment due to the widespread death of motor neurons.
rs80356547(http://omim.org/entry/314370#0002)
GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG

Primer Design

1.) Forward primer: CTTC[G]ACCT
Reverse primer: TCCA[G]CTTC

2.) Forward primer: TGTT[A]CAGG
Reverse primer: GGAC[A]TTGT


Illustration

Exponential amplification of a specific gene.