BME103:T130 Group 11 l2: Difference between revisions
| (14 intermediate revisions by 3 users not shown) | |||
| Line 43: | Line 43: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
Critical features to our design include an increase in tube space from 16 tube slots to 96. In doing this, the area of the heating plate is increased relative to the space the tubes take up. The increased area of the heating plate will require added ventilation to speed up the cooling process. The increased heating plate is necessary, because the PCR requires a series of heating up and cooling down the DNA to specific temperatures so that the DNA will multiply. | Critical features to our design include an increase in tube space from 16 tube slots to 96. In doing this, the area of the heating plate is increased relative to the space the tubes take up. The increased area of the heating plate will require added ventilation to speed up the cooling process. The increased heating plate is necessary, because the PCR requires a series of heating up and cooling down the DNA to specific temperatures so that the DNA will multiply. | ||
The benefits of increasing the tube space would be that the PCR would be more efficient. It would be more efficient because the Machine would be able to test more subjects at the same rate, allowing for increased amount of trials and increased amount of patients. | The benefits of increasing the tube space would be that the PCR would be more efficient. It would be more efficient because the Machine would be able to test more subjects at the same rate, allowing for increased amount of trials and increased amount of patients. This product would be more effective in a lab or clinic that performs mass testing for diseases. | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
Obtain the DNA samples in the 50 uL tubes each. | |||
Create a program on the machine as follows: | |||
Stage one: 1 cycle, 95 Degrees C for 3 minutes | |||
Stage two: 35 cycles, 95 Degrees C for 30 seconds, 57 Degrees C for 30 seconds, 72 Degrees C for 30 seconds | |||
Stage three: 72 Degrees C for 3 minutes | |||
Final hold: 4 Degrees C | |||
For the PCR reaction mix, up to 96 tubes (50 uL each). The mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer. | |||
Use transfer pipetts (only use each pipette once) to transfer the samples. | |||
After placing the samples in the tube space and securing the lid, begin the PCR Machine and wait until completion. | |||
| Line 76: | Line 93: | ||
| '''Supplied in the Kit''' || style="width: 400px;" | '''Amount''' | | '''Supplied in the Kit''' || style="width: 400px;" | '''Amount''' | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| SYBR Green I || style="width: 400px;" | | | SYBR Green I || style="width: 400px;" | 800 μL | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Calf Thymus DNA || style="width: 400px;" | | | Calf Thymus DNA || style="width: 400px;" | 800 μL | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| PCR tubes || style="width: 400 px;" | 95 tubes | | PCR tubes || style="width: 400 px;" | 95 tubes | ||
| Line 86: | Line 103: | ||
| Positive control || style="width: 400 pxl" | 1 | | Positive control || style="width: 400 pxl" | 1 | ||
|- style="height: 50 px;" | |- style="height: 50 px;" | ||
| Pipettes || style="width: 400 px;" | | | Pipettes || style="width: 400 px;" | 100 pipettes | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Microtubes || style="width: 400px;" | 93 tubes | | Microtubes || style="width: 400px;" | 93 tubes | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| | | Negative control || style="width: 400 px;" | 100 μL | ||
|- style="height: 50 px;" | |||
| Positive control || style="width:400 px;" | 100 μL | |||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Fluorimeter || style="width: 400 px;" | 1 | | Fluorimeter || style="width: 400 px;" | 1 | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| | | Smartphone stand || style="width: 400 px;" | 1 | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| CD with ImageJ software || style="width: 400 px;" | 1 | | CD with ImageJ and OpenPCR software || style="width: 400 px;" | 1 | ||
|- style="height:50 px;" | |||
| Primer 1 || style="width:400px;" | 20 ml | |||
|- style="height:50 px;" | |||
| Primer 2 || style="width:400px;" | 20 ml | |||
|- style="height:50px;" | |||
| Glass slides || style="width:400px;" | 20 | |||
|- style="height:50 px;" | |||
| Buffer || style="width:400px;" | 40 ml | |||
|- style="height:50 px;" | |||
| Eppendorf tubes || style="width: 400 px;" | 95 tubes | |||
|- style="height: 50 px;" | |||
| Box for fluorimeter || style"width: 400 px;" | 1 | |||
|} | |} | ||
| Line 111: | Line 142: | ||
|- style="height: 50px;" | |- style="height: 50px;" | ||
| Heatproof marker pen || style="width: 400 px;" | 1 | | Heatproof marker pen || style="width: 400 px;" | 1 | ||
|- | |- style="height: 50px;" | ||
| Cup for waste || style="width: 400 px;" | 1 | |||
|} | |} | ||
| Line 119: | Line 151: | ||
First, DNA samples were obtained from 31 different patients, each | First, DNA samples were obtained from 31 different patients, each were given 3 DNA samples. These DNA samples were stored in a freezer in microtubes. For patient number 1, his or her DNA samples were labelled 1a, 1b and 1c, using the heatproof marker. The other DNA samples from the remaining 30 patients were labelled in the same way. After all the DNA samples were obtained, each sample was transferred over to PCR tubes, which are tubes that are used especially for the PCR process. Each PCR tube was labelled in the same way as before. In addition to these 93 PCR tubes, two more tubes, each containing a negative control and a positive control respectively. The PCR tube containing the negative control was labelled "-" and the PCR tube containing the positive control was labelled "+". Using separate pipettes for each DNA sample and the controls, Primer 1 was added to every PCR tube. Once Primer 1 was added, Primer 2 was added to all the tubes as well, with separate pipettes still being used for all transfers. After these two primers are added, nucleotides are added in the same way. Finally, DNA Polymerase is added to all the PCR tubes. | ||
All 95 of the PCR tubes are placed into the PCR machine, and the software for the PCR machine was opened on the computer that the PCR machine was connected to. | All 95 of the PCR tubes are placed into the PCR machine, and the software for the PCR machine was opened on the computer that the PCR machine was connected to, and the PCR machine was automated for the necessary amount of heating and cooling cycles so as to produce a clear result. | ||
The settings on the PCR System are as follows: | |||
Stage one: 1 cycle, 95 Degrees C for 3 minutes | |||
Stage two: 35 cycles, 95 Degrees C for 30 seconds, 57 Degrees C for 30 seconds, 72 Degrees C for 30 seconds | |||
Stage three: 72 Degrees C for 3 minutes | |||
Final hold: 4 Degrees C | |||
For the PCR reaction mix, up to 96 tubes (50 uL each). The mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer. | |||
Use transfer pipetts (only use each pipette once) to transfer the samples. | |||
After placing the samples in the tube space and securing the lid, begin the PCR Machine and wait until completion. | |||
| Line 141: | Line 188: | ||
[[Image:BME103_Group11_FluorimeterProtocol.JPG|200px| A complete setup of the Fluorimeter ]] | [[Image:BME103_Group11_FluorimeterProtocol.JPG|200px| A complete setup of the Fluorimeter ]] | ||
After the heating and cooling cycles were done, all of the PCR tubes were taken out of the PCR machine. 95 Eppendorf tubes were filled with 400μL of buffer. Using separate pipettes for each tube (all of which were labelled according to the corresponding tube), all of the samples as well as the controls were transferred into these Eppendorf tubes. Each Eppendorf tube was labelled by the sample, as was earlier done for the PCR tubes, using the marker. Another Eppendorf tube was filled with the calf thymus DNA (standard at 2 micrograms/ml), and this tube was marked with a red dot on the top of the tube, using a marker. A scintillation vial was filled with deionized water, and another Eppendorf tube was almost completely filled with the SYBR Green I solution. The Eppendorf tube containing the SYBR Green I was marked on the top with a blue dot. | |||
The fluorimeter was switched on, and the smartphone was placed in the smartphone stand at a good angle to take photos of the results. The fluorimeter was switched on, and a glass slide was put into place so that the light shone through the middle of the first two rows on the slide. A pipette was used to place two large drops of the SYBR GREEN I solution onto the first two centered holes on the slide. Then, using the correct pipette, two dropes of the first DNA sample, sample 1a, was added to the droplet that had formed from the two drops of SYBR GREEN I. The light was aligned again to make sure that it was going through the center of the drop. The box was arranged to put the fluorimeter into darkness and the smartphone was used to take pictures of the droplet. Once enough pictures were taken, a pipette set aside especially for waste was used to remove the droplet and dispose of it in a cup set aside for waste. The glass slide was then moved forward so that the light shone through the center of the next two rows of holes. The process was repeated for each DNA sample and for the controls, as well as for the calf thymus DNA and the water in the scintillation vial. Each time, the corresponding pipettes for each tube was used, and kept separate from other pipettes so as to prevent contamination. Besides that, a new glass slide was used after 5 droplets were placed on the previous glass slide, and the used and contaminated glass slides were disposed of correctly. | |||
After all the images of the droplets containing the samples are taken, the ImageJ Software is utilized to measure the amount of the desired gene sequence in each droplet. For each drop, we split the color channels so that we can analyze only the green part of the image. The droplet is selected in the green part of the image, and then the green pixels are measured, called the Integrated Density. Using the same area of the droplet, we take a measurement from the dark background. Subtracting the density of the background from the droplet, we arrive at the Integrated Density that is used to determine the DNA density. DNA μg/mL is calculated by multiplying the Integrated density of the sample, with the background subtracted, by two and then dividing by the calf thymus integrated density. | |||
==Research and Development== | ==Research and Development== | ||
| Line 165: | Line 223: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
Web Link - http://www.britannica.com.ezproxy1.lib.asu.edu/EBchecked/topic/148824/cystic-fibrosis-CF/ | |||
| Line 170: | Line 230: | ||
'''Illustration''' | '''Illustration''' | ||
[[Image:Cystic.gif]] | |||
Two forms, normal (+) and mutant (Δ), of the cystic fibrosis gene were amplified using PCR primers labeled with HEX (H) and rhodamine (R) and assayed by surface-enhanced resonance Raman scattering (SERRS). (Adapted from Graham, D.; et al. Anal. Chem. 2002, 74 (5), 1069–1074.) | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Latest revision as of 21:40, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
In order to increase tube space, we increase the heating plate and increase the power proportionally to the size of the plate. We would also add more ventilation next to the heating plate in order to speed up the cooling process of the DNA. Key Features
Stage one: 1 cycle, 95 Degrees C for 3 minutes Stage two: 35 cycles, 95 Degrees C for 30 seconds, 57 Degrees C for 30 seconds, 72 Degrees C for 30 seconds Stage three: 72 Degrees C for 3 minutes Final hold: 4 Degrees C For the PCR reaction mix, up to 96 tubes (50 uL each). The mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer. Use transfer pipetts (only use each pipette once) to transfer the samples. After placing the samples in the tube space and securing the lid, begin the PCR Machine and wait until completion.
ProtocolsMaterials
PCR Protocol
Stage one: 1 cycle, 95 Degrees C for 3 minutes Stage two: 35 cycles, 95 Degrees C for 30 seconds, 57 Degrees C for 30 seconds, 72 Degrees C for 30 seconds Stage three: 72 Degrees C for 3 minutes Final hold: 4 Degrees C For the PCR reaction mix, up to 96 tubes (50 uL each). The mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer. Use transfer pipetts (only use each pipette once) to transfer the samples. After placing the samples in the tube space and securing the lid, begin the PCR Machine and wait until completion.
Research and DevelopmentCystic Fibrosis is a genetically inherited disease that is derived from the production of excessive mucous build up in the respiratory tract. This has a major effect on the body's endocrine system, more specifically in the digestive and respiratory systems.
More information on the gene can be found at http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35731153
The forward primer for this disease would be CAGTCGCAGACGGAGAGGCAT while the reverse primer for without the disease would be GTCAGCGTCTCCCTCTCCGTA. If the patient was positive for the cystic fibrosis mutation, the reverse primer would be GTCAGCGTCTGCCTCTCCGTA. The difference between the mutation and the normal strand is that the normal strand has the allele TCC where the mutation has TGC. So the C and the G is changed. When the primer is made and put into the PCR machine, it will only attach to the mutation strands. If the primer matches up, it will glow under a black light therefore indicating that the patient has the disease. If there is no glow, that means the patient does not have that type of cystic fibrosis.
Web Link - http://www.britannica.com.ezproxy1.lib.asu.edu/EBchecked/topic/148824/cystic-fibrosis-CF/
Illustration Two forms, normal (+) and mutant (Δ), of the cystic fibrosis gene were amplified using PCR primers labeled with HEX (H) and rhodamine (R) and assayed by surface-enhanced resonance Raman scattering (SERRS). (Adapted from Graham, D.; et al. Anal. Chem. 2002, 74 (5), 1069–1074.)
| |||||||||||||||||||||||||||||||||||||||||||||||||||



