BME103:W930 Group2 l2: Difference between revisions
No edit summary |
|||
| (28 intermediate revisions by 5 users not shown) | |||
| Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:MattMortensen.jpg|100px|thumb|Name: Matt Mortensen<br>Machine Engineer]] | | [[Image:MattMortensen.jpg|100px|thumb|Name: Matt Mortensen<br>Open PCR Machine Engineer]] | ||
| [[Image: | | [[Image:Garrett-BME103-Group2.jpg|100px|thumb|Name: Garrett Salcido<br>Open PCR machine engineer]] | ||
| [[Image: | | [[Image:Ramesh-BME103-Group2.jpg|100px|thumb|Name: Ramesh Tadayon<br>Experimental protocol planner]] | ||
| [[Image: | | [[Image:Alanie-BME103-Group2.jpg|100px|thumb|Name: Alanie Harmon<br>Experimental protocol planner]] | ||
| [[Image: | | [[Image:Alex-BME103-Group2.jpg|100px|thumb|Name: Alex Torres<br>R&D Scientist]] | ||
| [[Image:Davey-BME103-Group2.jpg|100px|thumb|Name: Davey Rand<br>R&D Scientist]] | |||
|} | |} | ||
| Line 33: | Line 34: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
Clearly our group was | Clearly our group was greatly focused on correcting the lid-opening system for the top of the lid to the box. We focused on designing a new hook-and-latch system for the lid because we felt that the nature of the current system was very inconvenient to the user. The current model is more difficult to open and yanking the system can create potential for harm to be done to the DNA samples as well as to the machine. Our new design corrects this by allowing means for a smooth and easy opening motion; the samples are still protected because the lid is secured by a hook when closed. Considering that our other modification by making the sides thicker was a means to make assembling the device easier, it is reasonable to conclude that overall, we were focused on making a more user-friendly device. | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
Altered instructions are only needed for the new hook-and-latch system: | Altered instructions are only needed for the new hook-and-latch system: | ||
Instead of instructions to screw the Strike into the top, there will only be instructions to insert the hook into the latch. There will already be another hook for it to catch on the bottom of the lid. There should also be a | Instead of instructions to screw the Strike into the top, there will only be instructions to insert the hook into the latch. There will already be another hook for it to catch on the bottom of the lid. There should also be a label for contact information in the event that the hook was damaged or lost in the shipping process. | ||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 62: | Line 63: | ||
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | <!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | ||
{|border="1" cellpadding="5" cellspacing="0" align="center" | |||
|- | |||
! scope="col" | '''Supplied in the Kit''' | |||
! scope="col" | '''Amount''' | |||
|- | |||
| Open PCR | |||
| $600-$800 | |||
|- | |||
|Extended Power Cord | |||
| $5-$10 | |||
|- | |||
|Thicker walls (easier to take apart) | |||
| <$5 | |||
|- | |||
| Fluorimeter | |||
| $400- $500 | |||
|- | |||
| Phone Stand | |||
| <$5 | |||
|} | |||
{|border="1" cellpadding="5" cellspacing="0" align="center" | |||
|- | |||
! scope="col" | ''' Supplied by User''' | |||
! scope="col" | '''Amount''' | |||
|- | |||
| Phone/Camera | |||
| Varies | |||
|- | |||
| Box | |||
| <$5 | |||
|- | |||
| Pipettes | |||
| <$5 | |||
|} | |||
'''PCR Protocol''' | '''PCR Protocol''' | ||
Step 1: Denaturation by Heat <br> | |||
Initially, heat separates a DNA strand into two separate strands. This is allowed because the hydrogen bonds that hold the DNA together are weak and easily separable when heated. <br> | |||
Step 2: Annealing Primer to Target Sequence<br> | |||
We want to target a sequence specifically and in order to accomplish that you must use primers. Primers mark the end of the target sequence. Two primers are included in the PCR; one for each of the strands that were just separated during denaturation. The beginning of the DNA target sequence is also marked by the primers that bind (anneal) to the complementary sequence. <br> | |||
Step 3: Extension<br> | |||
After the primers bind to the complementary DNA, the temperature is raised and the enzyme Taq DNA polymerase is used to replicate the strands. The Taq DNA polymerase, active at high temperatures, facilitates the binding and joining of the complementary nucleotides. It synthesizes an identical double-stranded DNA strand. Extension begins at the 3’ end of the primer because Taq DNA polymerase synthesizes exclusively in the 5’ to 3’ direction, so the free nucleotides are only added to the 3’ end of the primer. | |||
<br> | |||
| Line 71: | Line 125: | ||
'''DNA Measurement Protocol''' | '''DNA Measurement Protocol''' | ||
Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while maintaining the ability to use the smart phone to take pictures. | |||
<br> | |||
==Research and Development== | ==Research and Development== | ||
| Line 79: | Line 134: | ||
'''Background on Disease Markers''' | <u>'''Background on Disease Markers'''</u> | ||
Crohn's disease is a chronic, autoimmune inflammatory bowel disease (IBD) that causes inflammation of the digestive tract, also known as the gastrointestinal (GI) tract. Chronic, unmanaged inflammation can lead to a variety of symptoms. Researchers have also discovered genetic variations in certain regions of chromosome 5 and chromosome 10 that appear to contribute to Crohn disease risk. One area of chromosome 5, known as the IBD5 locus, contains several genetic changes that may increase the risk of developing this condition. Other regions of chromosome 5 and chromosome 10 identified in studies of Crohn disease risk are known as "gene deserts" because they include no known genes. The SNP's that are associated with this disease are rs11805303, rs10210302, rs9858542 in the BSN gene, rs17234657, rs1000113, rs10761659 and many more.- www.snpedia.com | |||
'''Primer Design''' | <u>'''Primer Design'''</u><br> | ||
<br> | |||
'''Rs11805303:'''<br> | |||
Sequences:<br> | |||
TGCTTGCAAACAGAGAACTGTTTCCT<FONT COLOR="FF0000">[C]</FONT>AAACGATCCACTTGCCTTTTATTAG<br> | |||
TGCTTGCAAACAGAGAACTGTTTCCT<FONT COLOR="FF0000">[T]</FONT>AAACGATCCACTTGCCTTTTATTAG<br> | |||
<br> | |||
'''Rs10210302:'''<br> | |||
Sequences:<br> | |||
AATACTGACTACCAGTGAACCATCTT<FONT COLOR="FF0000">[C]</FONT>AACTACAGTGCTAGAAGCCTGACTG<br> | |||
AATACTGACTACCAGTGAACCATCTT<FONT COLOR="FF0000">[T]</FONT>AACTACAGTGCTAGAAGCCTGACTG | |||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
| Line 93: | Line 159: | ||
'''Illustration''' | <u>'''Illustration'''</u> | ||
[[Image:Chromosome5BME103Group2.gif]] | |||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
Revision as of 01:34, 30 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials
Step 1: Denaturation by Heat
Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while maintaining the ability to use the smart phone to take pictures.
Research and DevelopmentBackground on Disease Markers Crohn's disease is a chronic, autoimmune inflammatory bowel disease (IBD) that causes inflammation of the digestive tract, also known as the gastrointestinal (GI) tract. Chronic, unmanaged inflammation can lead to a variety of symptoms. Researchers have also discovered genetic variations in certain regions of chromosome 5 and chromosome 10 that appear to contribute to Crohn disease risk. One area of chromosome 5, known as the IBD5 locus, contains several genetic changes that may increase the risk of developing this condition. Other regions of chromosome 5 and chromosome 10 identified in studies of Crohn disease risk are known as "gene deserts" because they include no known genes. The SNP's that are associated with this disease are rs11805303, rs10210302, rs9858542 in the BSN gene, rs17234657, rs1000113, rs10761659 and many more.- www.snpedia.com
| |||||||||||||||||||||







