BME103:W930 Group5 l2: Difference between revisions
| (16 intermediate revisions by 2 users not shown) | |||
| Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:Andrea2012.jpg|100px|thumb|Name: Andrea Carpenter<br>Role(s): Experimental Protocol Planner]] | | [[Image:Andrea2012.jpg|100px|thumb|Name: Andrea Carpenter<br>Role(s): Experimental Protocol Planner]] | ||
| [[Image:Photo_(1).JPG|100px|thumb|Name: Malik McLaurin<br>Role(s): Open PCR Machine Engineer]] | | [[Image:Photo_(1).JPG|100px|thumb|Name: Malik McLaurin<br>Role(s): Open PCR Machine Engineer]] | ||
| Line 28: | Line 28: | ||
'''System Design'''<br> | '''System Design'''<br><br> | ||
[[Image:PCR_labels.png|600x|]] | |||
This is the original system design, viewed with an open face from the side. The parts included in last weeks lab, along with the important parts included in this week's lab, are all diagramed. | |||
<br><br> | |||
'''Key Features'''<br> | '''Key Features'''<br> | ||
The following picture is a simple change in the design of the large exterior screw located on the top of the Open PCR lid: | The following picture is a simple change in the design of the large exterior screw located on the top of the Open PCR lid: | ||
| Line 39: | Line 40: | ||
The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them. | The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them. | ||
<br><br> | |||
Another change made on the machine was the hinge/lock of the heating lid: | |||
<br> | |||
[[Image:Side_lid.png]] | |||
<br> | |||
We removed the original locking mechanism (i.e. lid latch in diagram) and replaced it with two latches on both sides of the lid. The lid on the original Open PCR does not sit flush with the side of the machine, so the size of the lid will be expanded to fit the design. By changing the design of the latch, the lid will open much smoother and not require as much force. Also, by removing the difficult lock, the fear of breaking the Open PCR machine while opening the lid will diminish. By moving the latches to the side of the lid, room for a larger heating block is no longer obstructed, therefore the size of the heating block can be made larger and more samples can be tested. | |||
<br><br><br> | |||
Larger Heating Block: | |||
<br> | |||
[[Image:Heating_block.png|600px|]] | |||
<br> | |||
We expanded the heating block to fit 50 samples, instead of 16. The extra room for the heating block was accounted for in the lid design. By adding more room for samples to be tested, the user will save time in testing large numbers of samples because the machine is about 3 times more efficient. | |||
<br><br> | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
The instructions for setting up the new Open PCR machine will be almost identical to the original instructions. The original directions on how to install the lid lock will need to be omitted and replaced with directions on using the new latches. The new latches will come attached to the wooden exoskeleton of the PCR machine though, so the only instructions needed would be how to close the latches (which is basically self explanatory). Also, it should be included in the device's new instructions that the red line on the screw indicates when the screw is deep enough. Nothing needs to be changed on the directions of installing the new heating block, except possibly for the pictures to show 50 sample slots. | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 148: | Line 161: | ||
<u>'''PCR Protocol'''</u><br> | <u>'''PCR Protocol'''</u><br> | ||
# | #Make sure to have the Open PCR software downloaded onto your computer.<br> | ||
#Place PCR machine onto a sturdy surface and turn on machine. Plug the machine into an electrical outlet and connect the machine to your computer's USB port. <br> | |||
#Perform a Pre-Flight test by going under re-run an experiment; click on the list and select "a simple test"<br> | |||
#After reviewing the protocol click "start" and witness OpenPCR go through the procedure. <Br> | |||
#Once the machine has gone through he simple test, create a new program in the program by clicking on "Add a New Experiment"<br> | |||
#*Click on "more options"<br> | |||
#*Click on the plus symbol next to the initial step and put 95°C for temperature and 180 seconds for time.<br> | |||
#*In the third section, put in 30 for the number of cycles. <br> | |||
#*Set the denaturing temperature to 95°C and time to 30 seconds.<br> | |||
#*Set the annealing temperature to 57°C and time to 30 seconds.<br> | |||
#*Set the extending temperature to 72°C and time to 30 seconds.<br> | |||
#*Add a final step. Set the temperature to 72°C and the time to 180 seconds.<br> | |||
#*Set the final hold to 4°C.<br> | |||
#Transfer each extracted DNA sample into separate PCR micro test tubes.<br> | |||
#Add the 99.8μL of the PCR master mix to each DNA sample.<br> | |||
#Place each micro test tube in the PCR machine, including the provided positive and negative controls. <br> | |||
#Use a fine point Sharpie to label each test tube.<br> | |||
#Close the lid of the machine and tighten the screw on the lid clockwise to the marked red line, so that the lid barely touches the top of the test tubes.<br> | |||
#Click on "Plug in Open PCR to start" to being amplifying the DNA samples. <br> | |||
#Allow the machine to run thorough the program (this should take about two hours) to allow the PCR machine to amplify DNA 30 times. | |||
| Line 173: | Line 204: | ||
#Open the flap to the light box.<br> | #Open the flap to the light box.<br> | ||
#Use a clean labeled (as waste) pipette to remove the drop from the slide surface. Push the slide in further so that you are now using the next set of two holes. <br> | #Use a clean labeled (as waste) pipette to remove the drop from the slide surface. Push the slide in further so that you are now using the next set of two holes. <br> | ||
#Repeat steps | #Repeat steps 3, 4, 8-11 for each sample. When you run out of holes on the slide, put the used slide aside and bring out a new glass slide to use. <br> | ||
#Make sure you have the Image J software downloaded onto your computer.<br> | |||
#Once you have taken all the pictures, download them onto a computer (you can do this many different ways, using a USB 2.0 cord, email, etc.).<br> | #Once you have taken all the pictures, download them onto a computer (you can do this many different ways, using a USB 2.0 cord, email, etc.).<br> | ||
#Open the photos (you must do this image analysis one at a time) in the Image J program by going under <b>File</b> and selecting <b>Open</b> and choosing the desired images.<br> | #Open the photos (you must do this image analysis one at a time) in the Image J program by going under <b>File</b> and selecting <b>Open</b> and choosing the desired images.<br> | ||
| Line 179: | Line 211: | ||
#Select Image>Color>Split channels and three images should open. Choose the image named green.<br> | #Select Image>Color>Split channels and three images should open. Choose the image named green.<br> | ||
#Draw an oval surrounding the drop and choose analyze and measure. Record the necessary measurements. <br> | #Draw an oval surrounding the drop and choose analyze and measure. Record the necessary measurements. <br> | ||
#Obtain the background reading by moving the oval over the dark area surrounding the drop and | #Obtain the background reading by moving the oval over the dark area surrounding the drop and record the INTDEN and RAWINTDEN.<br> | ||
#Do the Image J processing for each photo. <br> | #Do the Image J processing for each photo. <br> | ||
#Subtract the INTDEN background measurement from the INTDEN drop measurement. <br> | #Subtract the INTDEN background measurement from the INTDEN drop measurement. <br> | ||
Latest revision as of 01:39, 30 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. This is the original system design, viewed with an open face from the side. The parts included in last weeks lab, along with the important parts included in this week's lab, are all diagramed.
The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them.
ProtocolsMaterials
(*)Positive control consists of calf thymus DNA Included in Fluorimeter Package:
Components of PCR master mix:
(*)Not actually included in kit, but must be added to the master mix by the user. Supplied by User
PCR Protocol
Research and DevelopmentBackground on Disease Markers For this experiment, our group chose to take an in-depth look at acute myeloid leukemia (AML). AML is a type of cancer that begins inside the bone marrow. The immune system of the human body is ultimately affected by AML, as bone marrow helps fight infections. The white blood cells that grow and form in bone marrow are turned into cancerous cells; the cells grow very quickly and sporadically, thus replacing healthy white blood cells. Our reference single nucleotide polymorphism associated with acute myeloid leukemia is rs121912500. In this SNP, the pathogenic allele for AML is classified as a single nucleotide variation. This means that only one nucleotide is altered in the allele causing AML. This variation results in a missense mutation. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121912500
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





