BME103:T930 Group 10 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Karmella Haynes (talk | contribs)
 
(16 intermediate revisions by 2 users not shown)
Line 12: Line 12:


{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|-
|- valign="top"
| [[Image:BME103student.jpg|100px|thumb|Name: Student<br>Role(s)]]
| [[Image:BME103student.jpg|100px|thumb|Name: Nolan Bidese<br>Role: Research and Development]]
| [[Image:BME103student.jpg|100px|thumb|Name: Evan Austin<br>Role: Open PCR Thermal Cycler Engineer]]
| [[Image:BME103student.jpg|100px|thumb|Name: Evan Austin<br>Role: Open PCR Thermal Cycler Engineer]]
| [[Image:Meeeeeeee.jpg|100px|thumb|Name: Aldin Malkoc <br>Role: Open PCR Thermal Cycler Engineer]]
| [[Image:Meeeeeeee.jpg|100px|thumb|Name: Aldin Malkoc <br>Role: Open PCR Thermal Cycler Engineer]]
Line 95: Line 95:
| align="center"style="background:#f0f0f0;"|'''Volume'''
| align="center"style="background:#f0f0f0;"|'''Volume'''
|-
|-
| PCR Reaction Mix (a.k.a. GoTaq Mix)||  
| *PCR Reaction Mix (a.k.a. GoTaq Mix)|| Amount in kit enough for given experiment
|-
| Taq DNA Polymerase ||
|-
| MgCl2, dNTP's, Forward and Reverse Primer|| Amounts are all supplied in kit
|-
|-
| align="center"style="background:#f0f0f0;"|'''DNA Samples'''
| align="center"style="background:#f0f0f0;"|'''DNA Samples'''
Line 110: Line 106:
| SYBR GREEN1||
| SYBR GREEN1||
|}
|}
*mix includes Taq DNA Polymerase, MgCl2, dNTP's, Forward and Reverse Primers<br>


{| {{table}}
{| {{table}}
Line 117: Line 114:
| Lab Coat||1 or 2
| Lab Coat||1 or 2
|-
|-
| PCR machine made of steel with top that snaps||must clip shut!
| PCR machine made of steel with top that snaps||PCR machine must clip closed
|-
|-
| Fluorimeter with built in camera and slides with dots farther apart||12 new glass slides
| Fluorimeter with built in camera and slides with dots farther apart||12 new glass slides
|-
|-
| micropipettes||at least 5 for mistakes
| Micropipettes||1 box, allow extras for mistakes
|-
|-
| Eppendorf tubes||you will have a whole box, but will need one for each test
| Eppendorf tubes||1 box, at least one for each test
|}
|}


Line 201: Line 198:
'''Background on Disease Markers'''
'''Background on Disease Markers'''


<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
The prostate is a gland in the male reproductive system located just below the bladder. It is about the size of a walnut and surrounds part of the urethra. The prostate gland helps to control urinary and sexual functions that are associated with the reproductive system.[http://www.cancer.gov/cancertopics/pdq/treatment/prostate/Patient] Risk Factors for prostate cancer are age, race, and family genetics of prostate cancer. The marker being used is rs137852593 [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=137852593] This SNP is associated with a defect in a protein in the prostate that may or may not cause cancer in the prostate. It is located on the X chromosome and the mutated protein goes from R [Arg] ⇒ L [Leu].
 


Leukemia is a type of cancer that affects the blood and bone marrow. The disease develops when blood cells produced in the bone marrow grow out of control. An estimated 44,600 new cases of leukemia are expected to be diagnosed in the United States in 2011. [http://www.lls.org/#/diseaseinformation/leukemia/] The marker being used for this is rs111033629.[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=111033629] The SNP is associated with a defect in a protein in bone marrow. It is located on the X chromosome and the mutated protein goes from M [Met] ⇒ I [Ile].




Line 209: Line 206:


<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
5'ACAAAGGAAAAAGTTCT'''ATT'''TC3'     
ATG ⇒ ATT The change in mutated protein
Reverse Primer: TGTTTCCTTTTTCAAGATAAAG


5'CAACTTACACTGGACGTCCAGA3'


CGC ⇒ CTC change in the mutated protein


Reverse Primer: GTTGAATGTGACCTGCAGGTCT


'''Illustration'''
'''Illustration'''


<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
 
[[Image:SNP.jpg]]
 
[http://www.sciencedirect.com/science/article/pii/S0167701206002247]
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Latest revision as of 01:45, 30 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Nolan Bidese
Role: Research and Development
Name: Evan Austin
Role: Open PCR Thermal Cycler Engineer
Name: Aldin Malkoc
Role: Open PCR Thermal Cycler Engineer
Name: Mikayle Holm
Role: Experimental Protocol Planner
Name: Coleen Fox
Role: Experimental Protocol Planner

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

Lid with highlighted area for magnets Lid with highlighted area for magnets Lid with highlighted area for magnets

Key Features
After using the Open PCR machine, we noticed a few components of the machine that could be improved. The biggest issue we encountered was that of the lid. When placing the tubes into the machine, it was very difficult to unlatch the lid from the base. Additionally, when screwing the heating plate down onto the tubes, it was difficult to tell how much the plate needed to be screwed down. With these problems in mind, we decided to redesign the lid by replacing two of the panels of the lid with plexi-glass and replace the hinge with magnets. By replacing two of the panels with plexi-glass, the user is able to see the heating plate being screwed down onto the tubes. This ensures that proper placement and rids of possible experimental errors. By replacing the hinge with magnets, we eliminate the difficulty experienced with the hinge. Also, placing magnets at the corners of the lid to hold the lid in place allows for greater visibility when adding the tubes to the tray.


Instructions


Assembly Instructions


1. Same procedure following up until lid.

2. There will be no latch

3. Screw in four magnets on machine top and lid at corners.

4. This will secure lid down to machine.

5. Follow instructions to adding side panels to lid with exceptions.

6. Exception: Replace two opposite sides on lid with plexi-glass


User Instructions


1. Follow all user Instructions with exception.

2. Exception 1: Lid can now come off entirely due to magnetic screws.

3. Will make it easier to adding vial tubes.

4. Exception 2: Use plexi-glass to see how much to screw down the heating pad.

5. Will ensure proper fit of heating lid.




Protocols

Materials For PCR Protocol

Supplied in the Kit Volume
*PCR Reaction Mix (a.k.a. GoTaq Mix) Amount in kit enough for given experiment
DNA Samples 50 μL each
Patients' DNA DNA of Rabbit Eyeball
Negative control Positive Control
SYBR GREEN1
  • mix includes Taq DNA Polymerase, MgCl2, dNTP's, Forward and Reverse Primers
Supplied by User Amount
Lab Coat 1 or 2
PCR machine made of steel with top that snaps PCR machine must clip closed
Fluorimeter with built in camera and slides with dots farther apart 12 new glass slides
Micropipettes 1 box, allow extras for mistakes
Eppendorf tubes 1 box, at least one for each test


PCR Protocol
BE CAREFUL NOT TO CROSS CONTAMINATE!!

1. Label Eppendorf Tubes with 1-17. Each tube should contain 50 microliters of one of the following substances:

Test Tube Contents
1 Positive Control
2 Negative Control
3 Patient 1, Replicate 1
4 Patient 1, Replicate 2
5 Patient 1, Replicate 3
6 Patient 2, Replicate 1
7 Patient 2, Replicate 2
8 Patient 2, Replicate 3
9 Patient 3, Replicate 1
10 Patient 3, Replicate 2
11 Patient 3, Replicate 3
12 Patient 4, Replicate 1
13 Patient 4, Replicate 2
14 Patient 4, Replicate 3
15 Patient 5, Replicate 1
16 Patient 5, Replicate 2
17 Patient 5, Replicate 3

Flickr photo by Clss1cr0ck3R

2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials.
3. Place 17 Eppendorf tubes containing DNA and GoTaq Mix in Open PCR Machine. This PCR machine is made of steel in order to decrease safety hazards, and is able to hold more Eppendorf tubes. Therefore, all 17 Eppendorf tubes fit in this PCR. The top of the PCR machine snaps shut and can be clipped down to be less dangerous.
4. To make up for the more Eppendorf tubes in the PCR machine, each cycle is increased by 2 degrees Celsius and more power is needed to increase temperature, making the Thermal Cycler program:
Stage One: 1 cycle, 97 degrees Celsius for 180 seconds
Stage Two: 35 cycles, 97 degrees Celsius for 30 seconds, 59 degrees for 30 seconds, 74 degrees Celsius for 30 seconds
Stage Three: 74 degrees Celsius for 180 seconds
Final Hold: 6 degrees Celsius
5. When PCR is complete, proceed to DNA Measurement Protocol

DNA Measurement Protocol
BE CAREFUL NOT TO CROSS CONTAMINATE!!

1. With permanent marker, clearly number micropipettes. With permanent marker, number Eppendorf tubes at the top. There should be 17 labeled micropipettes and 17 Eppendorf tubes.
2. Transfer each sample from PCR Eppendorf tubes to labeled (1-17) Eppendorf tubes containing 400 microliters of buffer. Get all of the sample into the Eppendorf tubes.
3. Take specially labeled Eppendorf tube (18) with SYBR GREEN I and using specially labeled micropipette (18) place 2 drops on first two centered drops on fluorimeter slide. These dots are further apart on this fluorimeter slide in order to avoid contamination.
4. Take diluted sample from labeled Eppendorf tubes and place 2 drops on top of sample of SYBR GREEN I drop.
5. Turn light on, place beam so that it is passing through the drop.
6. Take picture with built in camera to avoid variability on smart phone camera settings.
7. Use micropipette properly labeled with black strip for waste to discard sample.
8. Repeat 3-7 for all samples (Eppendorf tubes 1-17), the DNA of rabbit eyeball (Eppendorf tube 19), and scintillation vial.
9. Generate pictures in ImageJ to analyze results.

Research and Development

Background on Disease Markers

The prostate is a gland in the male reproductive system located just below the bladder. It is about the size of a walnut and surrounds part of the urethra. The prostate gland helps to control urinary and sexual functions that are associated with the reproductive system.[1] Risk Factors for prostate cancer are age, race, and family genetics of prostate cancer. The marker being used is rs137852593 [2] This SNP is associated with a defect in a protein in the prostate that may or may not cause cancer in the prostate. It is located on the X chromosome and the mutated protein goes from R [Arg] ⇒ L [Leu].

Leukemia is a type of cancer that affects the blood and bone marrow. The disease develops when blood cells produced in the bone marrow grow out of control. An estimated 44,600 new cases of leukemia are expected to be diagnosed in the United States in 2011. [3] The marker being used for this is rs111033629.[4] The SNP is associated with a defect in a protein in bone marrow. It is located on the X chromosome and the mutated protein goes from M [Met] ⇒ I [Ile].


Primer Design

5'ACAAAGGAAAAAGTTCTATTTC3'

ATG ⇒ ATT The change in mutated protein

Reverse Primer: TGTTTCCTTTTTCAAGATAAAG

5'CAACTTACACTGGACGTCCAGA3'

CGC ⇒ CTC change in the mutated protein

Reverse Primer: GTTGAATGTGACCTGCAGGTCT

Illustration

[5]