BME103:T130 Group 6 l2: Difference between revisions
| (21 intermediate revisions by 4 users not shown) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| [[Image:jocelynn.jpg|100px|thumb|Name: Jocelynn Christensen<br>Role: | | [[Image:jocelynn.jpg|100px|thumb|Name: Jocelynn Christensen<br>Role: <b>R & D</b> Scientist]] | ||
| [[Image:BME103_Group6_Ryan.png|100px|thumb|Name: Ryan Uchimura<br>Role: Experimental Protocol Planner/Coolest person ever]] | | [[Image:BME103_Group6_Ryan.png|100px|thumb|Name: Ryan Uchimura<br>Role: Experimental Protocol Planner/Coolest person ever]] | ||
| [[Image:Sam z pic.png|100px|thumb|Name: Sam Zimmerman<br>Role: OpenPCR Machine Engineer)]] | | [[Image:Sam z pic.png|100px|thumb|Name: Sam Zimmerman<br>Role: OpenPCR Machine Engineer)]] | ||
| [[Image: | | [[Image:AdamHelland.jpg|100px|thumb|Name: Adam Helland<br>Role:]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Dakota Styck<br>Role:]] | | [[Image:BME103student.jpg|100px|thumb|Name: Dakota Styck<br>Role:]] | ||
|} | |} | ||
| Line 34: | Line 34: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:OpenPCR Before After.png|800x400px]]<br> | |||
To the left is the original design of the OpenPCR machine and it only has 16 slots for test tubes which amounts to four patients. On the right is our redesign which has 64 slots which amounts to 16 patients. | |||
'''Key Features'''<br> | '''Key Features'''<br> | ||
The key feature we modified was the main heating block. We increased the number of samples it can hold from 16 to 64. Because of the increased size of the heating block, the overall size of the PCR Machine is increased. As you can see in the picture, the redesigned PCR machine is quite a bit larger than the original but its footprint is still small enough to be easy to move and easily fit on a countertop. The heating lid is also equipped with raised tabs such that when the heating lid is lowered on to the samples it stops before crushing the tubes. | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
As our redesign only modified the size of the OpenPCR machine, the assembly instructions are identical to the original assembly instructions which can be found on the [http://openpcr.org/build-it/ OpenPCR Website] | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 70: | Line 71: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td>gloves/labcoat - 1</td> | ||
<td> | <td>flourimeter - 1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td>PCR machine - 1</td> | ||
<td> | <td>Box - 1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td>Pipets - 16</td> | ||
<td> | <td>Smartphone holder - 1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> | <td>PCR reaction mix - 16 tubes, 50 μL each</td> | ||
<td> | <td></td> | ||
</tr> | </tr> | ||
<tr> | |||
<td>PCR holding tray - 1</td> | |||
<td></td> | |||
</tr> | |||
</table> | |||
<br> '''Supplied by User''' | |||
<table border="1" bordercolor="#000000" style="background-color:#FFFFFF" width="50%" cellpadding="3" cellspacing="3"> | |||
<tr> | <tr> | ||
<td> | <td>'''PCR'''</td> | ||
<td> | <td>'''Flourimeter'''</td> | ||
</tr> | |||
<tr> | |||
<td>Computer - 1</td> | |||
<td>Smartphone/Camera - 1</td> | |||
</tr> | |||
<tr> | |||
<td>DNA - 16 samples</td> | |||
<td>Image J Software - 1</td> | |||
</tr> | </tr> | ||
</table> | </table> | ||
| Line 99: | Line 115: | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
<br>1. Connect PCR to computer and install software.<br> | |||
2. Create a new program <br> | |||
set initial step to 95°C for 30 seconds, set for 30 cycles<br> | |||
denaturing- set temperature to 95°C for 30 seconds<br> | |||
annealing- set temperature to 57°C for 30 seconds<br> | |||
extension- set temperature to 72°C for 180 seconds, set to hold at 4°C<br> | |||
3. collect DNA samples | |||
4. mix each DNA sample with individual PCR solution (one pipet per sample) | |||
5. place DNA mixed with the PCR solution in the PCR machine | |||
6. once PCR is complete extract samples | |||
| Line 123: | Line 148: | ||
7. Repeat steps for one picture of each sample. <br> | 7. Repeat steps for one picture of each sample. <br> | ||
8. Save your data in an excel page for easy access at another time<br> | 8. Save your data in an excel page for easy access at another time<br> | ||
<font face="century gothic"> | |||
==Research and Development== | ==Research and Development== | ||
<!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers ---> | <!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers ---> | ||
'''Breast Cancer Markers''' | |||
<br> <br>Without including skin cancer, breast cancer is the most frequently diagnosed cancer in women today. While there's not one specific "cause" of breast cancer many things like excessive weight gain after age 18, use of estrogen and progestin hormone therapy, physical inactivity, as well as alcohol consumption have all been identified as risk-factors for breast cancer. While those may be avoidable risks there are some risks that cannot be avoided because they're genetically encoded in our DNA. Breast cancer has been linked to certain genetic mutations in the BRCA1 gene as well as the BRCA2 gene. While having a mutation of either of these genes doesn't guarantee breast cancer, someone with a mutation on either gene is 5 times more likely to develop breast cancer during their life. <br> | |||
The BRCA1&2 genes have been identified as tumor suppressor genes on the 17th chromosome. Specifically looking at BRCA1, the gene encodes a nuclear phosphoprotein who's job is to maintain genomic stability and act as a tumor suppressor. This protein plays a huge role in transcription, DNA repair, and recombination. When this gene is mutated it's responsible for nearly 40% of inherited breast cancers. <br><br> | |||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
<br><br>There are thousands of mutations associated with the BRCA1 gene. <br> | |||
<ul>Here are two examples:<br> | |||
<li> <b>Single Nucleotide Polymorphism (SNP) - <font color="red">rs799917</font color></b><br> | |||
[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=799917 NCBI database rs799917] <br> | |||
<u>Location:</u> <i>Chromosome 17 at position 41,244,936bp. </i><br> | |||
<u>Variation Type:</u> <i>Single Nucleotide Variation</i>; Missense Mutation<br> | |||
<u>Reference strand (<i>41,244,962 bp-41,244,911 bp</i>):</u> | |||
<br><b>3'</b> GGTTTCAAAGCGCCAGTCATTTGCTC[<font color="red">A</font color>/C/<font color="red">T</font color>*]GTTTTCAAATCCAGGAAATGCAGAA<b> 5'</b><br> * This represents C as the normal base and A/T as the possible mutations for this SNP.<br> | |||
<i>If Cytosine is replaced by Adenine or Thymine in this sequence the resulting amino acid would either be glutamine or leucine respectively instead of proline. This change in amino acids will result in an alteration to the overall protein. Something this small is what could cause a cancerous gene.</i> | |||
<br><br> | |||
<li> | |||
<b>Single Nucleotide Polymorphism - <font color="red">rs4986852</font color></b><br> | |||
[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=4986852 NCBI database rs4986852] <br> | |||
<u>Location:</u> <i>Chromosome 17 at position 41,244,429bp. </i><br> | |||
<u>Variation Type:</u> <i>Single Nucleotide Variation</i>; Missense Mutation<br> | |||
<u>Reference strand (<i>41,244,455 bp-41,244,404 bp</i>): </u> | |||
<br><b>3'</b> TAGAGAAAATGTTTTTAAAGAAGCCA[<font color="red">A</font color>/G*]CTCAAGCAATATTAATGAAGTAGGT<b> 5'</b> <br> | |||
* This represents G as the normal base and C as the possible mutation for this SNP.<br> | |||
<i>If Guanine is replaced with Cytosine then Asparagine will be produced instead of Serine which will also cause a change in the protein that has been connected to BRCA1.</i> | |||
<br></li> | |||
</ul> | |||
<br><br> | |||
'''Primer Design'''<br> | |||
In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.<br> | |||
<br><ul><li><b>SNP - rs799917</b><br> | |||
<b><u>Forward Primer:</u> <br> | |||
5'</b> GCTTATCTTTCTGACCAACC <b>3'</b><br> | |||
<i>located at approximately 41,244,736bp - 41,244,756bp; 200bp to the left of the mutation</i><br> | |||
<b><u>Reverse Primer:</u><br> | |||
3'</b> TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA <b>5'</b><br><br></li> | |||
<li><b>SNP - rs4986852</b><br> | |||
<b><u>Forward Primer:</u><br> | |||
5'</b> CAGGGATGCTTACAATTACTT <b>3'</b><br> | |||
<i>located at approximately 41,244,229bp -41,244,249bp; 200bp to the left of the mutation</i><br> | |||
<b><u>Reverse Primer:</u><br> | |||
3'</b> AAAGAAGCCA<font color="red">A</font color>CTCAAGCAA <b>5'</b></li></ul> | |||
<i>The primers are designed specifically to bind with DNA that contains the mutated allele. Once the primers bind to the DNA, then the Taq-polymerase knows where to replicate and the sequence containing the disease DNA will be replicated and amplified. Consequently, if the DNA does not contain the pathogenic allele then the primers won't be able to bind and nothing will be replicated. </i> | |||
< | <br><br> | ||
'''Illustration'''<br> | |||
'''Illustration''' | |||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:Pcrdiagram.gif|464×598px]]<br> | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Latest revision as of 01:52, 30 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||
OUR TEAMLAB 2 WRITE-UP
PCR Machine Improvements
Thermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
DNA Measurement Protocol
Research and DevelopmentBreast Cancer Markers
Background on Disease Markers
The primers are designed specifically to bind with DNA that contains the mutated allele. Once the primers bind to the DNA, then the Taq-polymerase knows where to replicate and the sequence containing the disease DNA will be replicated and amplified. Consequently, if the DNA does not contain the pathogenic allele then the primers won't be able to bind and nothing will be replicated.
|
|||||||||||||||||||





