SBB13Ntbk-Harini Sadeeshkumar: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 109: | Line 109: | ||
4. 0.5uL BamHI | 4. 0.5uL BamHI | ||
5. Incubate at 37 degrees on the thermocycler for 1hr | 5. Incubate at 37 degrees on the thermocycler for 1hr | ||
Run on gel | |||
cut out band | |||
begin gel purification--stop after gel is dissolved in ADB buffer | |||
3/19/13- Finish gel cleanup | |||
gel purification: | |||
1. cut out bands minimizing extra gel matter. | |||
2. put in ependorf tube and add 600uL of Zymo ADB buffer (brown bottle). | |||
3. heat at 55, shake and/or vortex until the gel has dissolved. | |||
4. If the DNA is <300bp add 250uL of isopropanol | |||
5. transfer into the Zymo column inside a collection tube (small clear guys) | |||
6. spin through, discard waste. | |||
7. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) | |||
8. spin through, discard waste. | |||
9. Add 200 uL of Zymo Wash Buffer | |||
10. spin through, discard waste. | |||
11. spin for 90 seconds, full speed to dry. | |||
12. elute with water into a fresh Eppendorf tube | |||
</pre> | </pre> | ||
Revision as of 16:54, 19 March 2013
Vanillin - quiC-3
PCA quiC-3_oligo_1-16 (460 bp, pca1) PCR pca1 with quiC-3_oligo_11/quiC-3_oligo_15 (460 bp, pca2) Digest pca2, gp (EcoRI/BamHI, 20+415+25 bp, pcr_dig) (get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig) Ligate pcr_dig and vect_dig (pBca9145-quiC-3) ------------------------------- <quiC-3_oligo_1 TGATCTAATTGCAATTCCAATCCTGTTTCCATGAACCTTATTTGAATCGAA <quiC-3_oligo_2 TCGTAGGTAATAAGTTCGAGAACTATTCTGACGGTTTGCAAATCAATTGGG <quiC-3_oligo_3 TCCTTCGTGTTCCAAAGCTGGAACACCGAAAACGATTGCACCTAATCTTTG <quiC-4_oligo_4 TCAATTTAACAGGAGATGGTAACATTTTCGATTCAAATAAGGTTCATGGAA <quiC-5_oligo_5 GTGTTCCAGCTTTGGAACACGAAGGATTTGTAGGTTCTATGAGACGGCATG <quiC-6_oligo_6 GTAAAAGAAACTACATTGCTTATAATGAATTGACAAATAACTCTTTGGGTT <quiC-7_oligo_7 CATTAACTAAGAACCAAATTTGGGATAATGGAAAGGACATCAAGAGGTGTG <quiC-8_oligo_8 ATTTGGAACACAAGAACCTCCAGCTTCACACCTCTTGATGTCCTTTCCATT <quiC-9_oligo_9 ATTATAAGCAATGTAGTTTCTTTTACCCCAATTGATTTGCAAACCGTCAGA <quiC-10_oligo_10 ATCCCAAATTTGGTTCTTAGTTAATGTGATTCTTGCATTAGCATCCTTTTC <quiC-11_oligo_11 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAAATGCTG <quiC-12_oligo_12 ATAGTTCTCGAACTTATTACCTACGACAGCATTTGAGACGATGCAGATCTCA <quiC-13_oligo_13 ACAGGATTGGAATTGCAATTAGATCAGAAAAGGATGCTAATGCAAGAATCA <quiC-14_oligo_14 AATGTTACCATCTCCTGTTAAATTGAAACCCAAAGAGTTATTTGTCAATTC <quiC-15_oligo_15 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAACCTACAAA <quiC-16_oligo_16 AAGCTGGAGGTTCTTGTGTTCCAAATCAAAGATTAGGTGCAATCGTTTTCG ---------------------------------- pca1/pca2: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAAATGCTGTGAGATCTGCATCGTCTCAAATGCTGTCGTAGGTAATAAGTTCGAGAACTATTCTGACGGTTTGCAAATCAATTGGGGTAAAAGAAACTACATTGCTTATAATGAATTGACAAATAACTCTTTGGGTTTCAATTTAACAGGAGATGGTAACATTTTCGATTCAAATAAGGTTCATGGAAACAGGATTGGAATTGCAATTAGATCAGAAAAGGATGCTAATGCAAGAATCACATTAACTAAGAACCAAATTTGGGATAATGGAAAGGACATCAAGAGGTGTGAAGCTGGAGGTTCTTGTGTTCCAAATCAAAGATTAGGTGCAATCGTTTTCGGTGTTCCAGCTTTGGAACACGAAGGATTTGTAGGTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT 3/8/13 -- Assembly Step: Assembly: 1. 38 uL ddH2O 2. 5 ul 10x expand buffer 3. 5 ul 2mM dNTPs 4. 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) 5. 0.75 ul Expand polymerase Program (can run JCA/PCA1) 1. 2 min initial denature at 94oC 2. 30 sec denature at 94oC 3. 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] 4. 30 sec extension at 72oC 5. repeat 2-4 30 times total 3/12/13 -- Zymo Cleanup and Amplification Zymo Cleanup: 1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. 2. Transfer into the Zymo column (small clear guys) 3. spin through, discard waste. 4. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) 5. spin through, discard waste. 6. Add 200 uL of Zymo Wash Buffer 7. spin through, discard waste. 8. spin for 90 seconds, full speed to dry. 9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction Amplification: 1. 1 ul each outer oligo (10 uM) 2. 1 ul purified pca product 3. .5 ul phusion 4. 10 ul 5x phusion buffer 5. 5 ul 2mM dNTPs 6. 32.5 ul H2O Program 1. 2 min initial denature at 94oC 2. 30 sec denature at 94oC 3. 30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product] 4. 30 sec extension at 68oC 5. repeat 2-4 30 times total 3/14/13- Zymo Cleanup, Digestion, Run on gel Digestion: 1. 8uL of eluted PCR product 2. 1uL of NEB Buffer 2 3. 0.5uL EcoRI 4. 0.5uL BamHI 5. Incubate at 37 degrees on the thermocycler for 1hr Run on gel cut out band begin gel purification--stop after gel is dissolved in ADB buffer 3/19/13- Finish gel cleanup gel purification: 1. cut out bands minimizing extra gel matter. 2. put in ependorf tube and add 600uL of Zymo ADB buffer (brown bottle). 3. heat at 55, shake and/or vortex until the gel has dissolved. 4. If the DNA is <300bp add 250uL of isopropanol 5. transfer into the Zymo column inside a collection tube (small clear guys) 6. spin through, discard waste. 7. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) 8. spin through, discard waste. 9. Add 200 uL of Zymo Wash Buffer 10. spin through, discard waste. 11. spin for 90 seconds, full speed to dry. 12. elute with water into a fresh Eppendorf tube