BME103 s2013:T900 Group5 L3: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
Line 153: Line 153:
'''MATERIALS'''
'''MATERIALS'''


Supplied by kit:
Supplied by kit:<br>
dNTPs<br>
dNTPs<br>
Reaction buffers<br>
Reaction buffers<br>
Line 159: Line 159:
MgCl2 <br>
MgCl2 <br>
<br>
<br>
Supplied by Users
Supplied by Users:<br>
Sample DNA<br>
Sample DNA<br>
Forward and Reverse Primers<br>
Forward and Reverse Primers<br>

Latest revision as of 06:04, 17 April 2013

BME 103 Spring 2013 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Cody Gates
Camera Operator
Name: Alexander Oropel
Research and Development Scientist
Name: Matt McClintock
Data Analyzer/Protocol
Name: Heewon Park
Machine/ Device Engineering
Name: Student
Role(s)

LAB 3 WRITE-UP

Original System: PCR Results

PCR Test Results

Sample Name Ave. INTDEN* Calculated μg/mL Conclusion (pos/neg)
Positive Control 5725984.00 11.66 μg/mL N/A
Negative Control 2820659.67 4.50 μg/mL N/A
Tube Label: 1 Patient ID: 92336 rep 1 4902761.33 9.63 μg/mL pos
Tube Label: 2 Patient ID: 92336 rep 2 4957051.00 9.77 μg/mL pos
Tube Label: 3 Patient ID: 92336 rep 3 5446934.67 10.93 μg/mL pos
Tube Label: 4 Patient ID: 44606 rep 1 2497338.33 3.70 μg/mL neg
Tube Label: 5 Patient ID: 44606 rep 2 2202675.67 2.97 μg/mL neg
Tube Label: 6 Patient ID: 44606 rep 3 1789569.00 1.95 μg/mL neg

* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images


Bayesian Statistics
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.

Bayes Theorem is an equation in probability theory and statistics that relates inverse representations of probabilities concerning two events, or rather, it expresses a degree of change when accounting for evidence. Bayes Theorem is represented as follows:

    P(A|B) = P(B|A) * P(A) / P(B)

Which can be read as

    the probability of A given B = (the probability of B given A * the probability of A) / the probability of B

This information will be utilized to determine various probabilities listed below when accounting for the positive/negative values determined by the entire class as well as an outside document listing the actual yes/no cancer diagnosis


Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.

  • A = Cancer-Positive Conclustion = 9/20 = .45
  • B = Positive PCR Reactions = 26/60 = .433
  • P (B|A) = Positive PCR given cancer Positive conclustion = 11/13 = .846
  • P(A|B) = .879=88%


Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.

  • A = Cancer negative conclustion = 11/20 = .55
  • B = Negative PCR reactions = 17/30 = .567
  • P (B|A) = Negative PCR given cancer-negative conclustion = 16/17 = .94
  • P(A|B) = .911 = 91%


Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.

  • A = "yes" cancer diagnosis = 7/20 = .35
  • B = "positive" test conclusion = 9/20 = .45
  • P (B|A) = Positive given yes = 6/20 = .3
  • P(A|B) = .233 = 23%


Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.

  • A = "no" cancer diagnosis = 13/20 = .65
  • B = "negative" test conclusion = 11/20 = .55
  • P (B|A) = Negative given no = 1/2 = .5
  • P(A|B) = .591 = 59%

New System: Design Strategy

We concluded that a good system "Must Have":

  • Results that are easy to determine. This means a clear indication of positive or negative results when compared to the controls. This is integral to the design success because the results must be easy differentiable as to not require re-testing.
  • Software that is simple to use. The software for open PCR is incredibly easy to use and a program similar would be ideal. Anything that requires computer coding or computational design is too complicated, so the software must already be made to use. A user should be able to plug in the information he or she wants and get the desired response from the software, no computing needed.


We concluded that we would Want a good system to have:

  • Samples that are easily identifiable throughout the experiment. This means that there is no changing of labels or titles for the samples. This is important because it is crucial to keep the samples consistent and not mixed up. When transferring the samples there should be prepared labels to keep them straight.
  • Accessibility. This means that anyone can access the materials needed and replicate the findings. For the purpose of DNA amplification no advanced technology is required, the PCR machine is easy for anyone to access.


We concluded that a good system Must Not Have:

  • High cost. This means that the system must not be too expensive. This is important because the system should be replicable and useful to everyone.
  • inconsistent timing. This was the most annoying problem with the original PCR design. The PCR machine kept changing times, and the group was unsure if the amplification was taking place properly. This also made it impossible to gauge the rest of the experiment timing which delayed the experiment and forced the group to reschedule further testing.

We concluded that a good system Should Avoid:

  • High energy consumption. Possible options are a battery or solar power. Not only would this make the experiment accesible at any location, it is a more sustainable option.
  • Manual analysis of the images. This was the most tedious process of the experiment. ImageJ was useful in providing a medium for calculating light density, but a program that could do calculations on its own would be ideal.




New System: Machine/ Device Engineering

Rather than consuming loads amount of energy with the PCR's technology, our new PCR will be solar battery powered.

SYSTEM DESIGN

http://i47.tinypic.com/65tt9e.jpg
http://i50.tinypic.com/35m42s8.jpg


Our PCR will be powered by a removable battery that will be power by the energy provided by the sun. The solar power PCR will be not only be energy efficient, but it will also be cheaper to run, and more accessible. Using this solar power system will also give the PCR more power to run and ultimately give the new PCR more accurate and faster results.
KEY FEATURES We chose to include these new features

  • Solar Battery - A removable solar battery that can be placed in the sun for hours at a time to receive energy for the PCR. This solar powered battery will create 10x more energy than a normol plug outlet can provide making the PCR, making the timing for each cycle faster and and more time consistent. The new PCR system will also have a lesser price to its users and will not consume nearly as much energy.
  • Plug - A area inside the PCR where the solar powered battery can be placed to turn on the PCR. This part will let the PCR be able to intake the great amount of energy that it will receive and and use the energy efficiently.


INSTRUCTIONS
1. Plug the solar battery into the plug
2. Load into PCR samples into the the PCR plate
3. Connect the device into a computer
4. Turn the PCR on
5. Start the computer program the PCR uses




New System: Protocols

DESIGN

We chose to include these new approaches/ features

  • Plastic case - PCRs are normally found in a lab setting where safety is a big issue. Rather that having a wooden shield which is very flammable, the new shield will be be made out of plastic which will make it safer and possibly more cost efficient.
  • Solar power battery - the new battery will be more cost efficient, collect more power and will be more sustainable.
  • Plug inlet - the plug inlet will allow the solar battery plug to go into the PCR and will use the energy that is provided by the battery to be used efficiently.


MATERIALS

Supplied by kit:
dNTPs
Reaction buffers
Taq DNA Polymerase
MgCl2

Supplied by Users:
Sample DNA
Forward and Reverse Primers
SYBR Green dye
Solar powered battery


PROTOCOLS

  • PCR Protocol

Thermal Cycler Program

Stage 1

   95°C for 3 minutes

Stage 2 35 cycles for each of the steps, each cycle will last for 30 seconds

   1)95°C
   2)57°C
   3)72°C

Stage 3

   Final Hold at 4°C


  • DNA Sample Set-up Procedure

Step 1

   Insert fully charged battery in to PCR

Step 2

   Prepare PCR Reaction Mix and DNA sample solutions

Step 3

   Using a pipette, add  50μL of the DNA solutions into a labeled tube (tube should correspond with the solution)

Step 4

   Place tubes in the PCR

Step5

   Run the PCR program




New System: Research and Development

BACKGROUND

Polymerase chain reaction is the process of amplifying a strand of DNA from a DNA template strand. From here the scientist is capable of amplifying any specific gene they choose. In this research we are targeting the single nucleotide polymorphism that is rs1787996, which contains a single nucleotide variation or SNV. The CHEK2 gene is essentially a gene that is capable of coding for susceptibility to breast cancer. The relation to SNP is that it is essentially a variation of the CHEK 2 gene that is present within humans, or Homo sapiens. The cancer-related function of the gene is that it essentially changes the base Thymine to Cytosine, changing the normal allele ATT to ACT, which is the cancer related allele.


DESIGN


Primers for PCR
Amplification of cancer-associated DNA

Cancer allele forward primer: 5' TATGTATGCACTGTAAGAGTT

Cancer allele reverse prime: 5' CTAGGAGAGCTGGTAATTTGG

A disease allele will give a PCR product because the primer associated with the process will identify the sequences that will code for cancer. From there the primer will allow for nucleotide bases to be placed in a reverse sequence from the template DNA. Essentially this will continuously amplify the cancerous DNA gene while the PCR process is in effect.


Our primers address the following design needs

  • Design specification 1 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
  • Design specification 2 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
  • Etc.




New System: Software

[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]