SBB13Ntbk-SeeYoungLee: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(42 intermediate revisions by the same user not shown)
Line 1: Line 1:
== May 2, 2013 ==
'' Today, we did the mapping of the pG001-Faccomt vector again and ran the gel. However, none of the plasmids gave the right band sizes. ''
== April 30, 2013 ==
'' My partner ligated the synthons, did the vector digest, and did the transformation and picked 6 white colonies from the plate over the weekend. After that, he picked the colonies and grew them in LB+CM and miniprepped the pGG001-Faccomt vectors. Today we are going to try to map the pG001-Faccomt vector with BsaI using the following protocol: ''
1. Map the 6 candidates with BsaI
8 uL ddH2O
1uL Miniprepped plasmid
1uL 10x NEB Buffer 2
0.5uL BsaI
2. Run the gel.
'' The bands were very faint. We should try running the gel again in the next lab ''
== April 25, 2013 ==
'' Colonies were picked by the instructor the day before, but no colonies were grown. So I checked the sequence of the synthons again and confirmed that the synthons can be assembled together and inserted into GG01 vector. Therefore, I decided to run a BsmB1 digest and perform gel purification. Then, I am going to carry out a golden gate assembly. First, the digest was setup and performed using the following procedure: ''
1uL NEB buffer 3
1uL per construct
0.5uL BsmB1
5.5uL ddH2O
Then, incubate in thermocycler at 55°C for 1 hour.
== April 23, 2013 ==
'' Today I am performing transformation process again to see if I can obtain some colonies this time. Again, the transformation was carried out using the following procedures. ''
''' Transformation by Heat-Shock '''
1. Thaw a 200 uL aliquot of cells on ice.
2. Add 20 uL of KCM to the cells.
3. Put your ligation mixture on ice, let cool a minute or two.
4. Add 70 uL of the cell cocktail to the ligation, stir to mix
5. Let sit on ice for 10 min.
6. Heat shock for 90 seconds at 42°C.
7. Put back on ice for 1 min.
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.
== April 19, 2013 ==
'' The transformation failed and there were no colonies on the plate. So the golden gate was performed again using the following setup ''
4.5uL ddH2O
1uL Ligase buffer
0.5uL Ligase
0.5uL BsmB1
1uL per construct
0.5uL Vector
== April 18, 2013 ==
''' Transformation by Heat-shock '''
1. Thaw a 200 uL aliquot of cells on ice.
2. Add 20 uL of KCM to the cells.
3. Put your ligation mixture on ice, let cool a minute or two.
4. Add 70 uL of the cell cocktail to the ligation, stir to mix
5. Let sit on ice for 10 min.
6. Heat shock for 90 seconds at 42°C.
7. Put back on ice for 1 min.
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.
== April 16, 2013 ==
'' Today, the sequencing data came in and I analyzed the data to choose the better clone of the two. I ended up choosing FaCCOMT-1A. Then, I performed a golden gate assembly using the following setup ''
4.5uL ddH2O
1uL Ligase buffer
0.5uL Ligase
0.5uL BsmB1
1uL per construct
0.5uL Vector
== April 11, 2013 ==
''' Miniprep '''
1. Pellet 2mL saturated culture by spinning full speed, 30 seconds in a 2mL Microcentrifuge tube. (''Did it twice with 1mL tube'')
2. Dump supernatant.
3. Add 250uL of P1 buffer into each tube. Resuspend the cells thoroughly.
4. Add 250uL of P2 buffer. Gently mix up and down. Solution should become clearer.
5. Add 350uL of N3 buffer. Slowly invert a few times, then shake.
6. Spin in centrifuge at top speed for 10 minutes.
7. Label blue columns with an alcohol-resistant lab pen.
8. Pour liquid into columns, and place the columns into the centrifuge. Spin at full speed for 15 seconds.
9. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin).
10. Wash each column with 500uL of PB buffer.
11. Spin in centrifuge at full speed for 15 seconds, then flick out the liquid again.
12. Wash with 750uL of PE buffer.
13. Spin in centrifuge at full speed for 15 seconds and flick out liquid again.
14. Spin in centrifuge at full speed for 90 seconds to dry off all water and ethanol.
15. Label new Microcentrifuge tubes and put columns in them.
16. Elute them by adding 50uL of water down the middle of the column (don't let it stick to the sides).
17. Spin in centrifuge at top speed for 30 seconds.
18. Take out columns and cap the tubes.
19. Clean up - note the P1 buffer is stored at 4°C and all the rest at room temperature.
''' Mapping '''
Setup:
6 uL ddH2O
2uL Miniprepped plasmid
1uL 10x NEB Buffer 2
0.5uL EcoRI
0.5uL XhoI
1. Incubate at 37°C for 30 minutes.
2. Run an analytical gel
== April 9, 2013 ==
'' This time, there are colonies on the plate. I can finally move on to picking of the colonies. ''
''' Picking of Colonies '''
1. Add 5mL of LB media with ampicilin to a clean test tube.
2. Pick a well-isolated, round, and "normal" looking colony with a micropipette tip.
3. Eject it in the test tube.
4. Incubate at 37°C overnight.
== April 4, 2013 ==
'' Today I am re-attempting ligation and transformation procedures to see if I can obtain colonies this time ''
''' Ligation of Eco/Bam Digests '''
Setup:
6.5uL ddH2O
1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
1uL Vector digest
1uL Insert digest
0.5uL T4 DNA Ligase
Protocol:
1. Pound upside down on the bench to mix.
2. Give it a quick spin to send it back to the bottom of the tube.
3. Incubate on the benchtop for 30 mins.
4. Put on ice and proceed to the transformation.
''' Transformation by Heat-shock '''
1. Thaw a 200uL aliquot of cells on ice.
2. Add 30uL of KCM to the cells.
3. Put your ligation mixture on ice, let cool a minute or two.
4. Add 70uL of the cell cocktail to the ligation, stir to mix.
5. Let sit on ice for 10 min.
6. Heat shock for 90 seconds at 42°C.
7. Put back on ice for 1 min.
8. Add 100uL of 2YT.
9. Plate 170uL on ampicilin, let incubate at 37°C overnight.
'' I made a minor change to the procedure and omitted the addition of 50uL of water. ''
== April 2, 2013 ==
'' There were no colonies on the plate. There was a systematic error in the experiment, possibly during the ligation step. So I went back to the Eco/Bam digest step without running on gel and went straight to zymo cleanup using the following procedure. ''
Setup:
1. 8uL of eluted PCA2 product
2. 1uL of NEB Buffer 2
3. 0.5uL EcoRI
4. 0.5uL BamHI
Protocol:
1. Incubate at 37°C on the thermocycler for 1 hour.
2. Transfer into the Zymo column inside a collection tube.
3. Add 180uL of ADB buffer.
4. Spin through, discard waste.
5. Add 200uL of Zymo Wash Buffer.
6. Spin through, discard waste.
7. Add 200uL of Zymo Wash Buffer.
8. Spin through, discard waste.
9. Spin for 90 seconds, full speed to dry.
10. Elute with 8uL of water into a fresh Eppendorf tube.
'' We also ran the PCR digest on an agarose gel to see if there are bands. If there are no bands, it would indicate that we have lost our DNA during the zymo cleanup step. The gel was run using the following setup. ''
1. 1uL of PCR digest
2. 0.5uL of 6X loading dye
'' There were no bands in my lane, which implies that my DNA was lost somewhere along the step, possibly during zymo purification. ''
== March 21, 2013 ==
''' Ligation of EcoRI/BamHI Digests '''
Setup:
6.5uL ddH2O
1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
1uL Vector digest
1uL Insert digest
0.5uL T4 DNA Ligase
Protocol:
1. Pound upside down on the bench to mix.
2. Give it a quick spin to send it back to the bottom of the tube.
3. Incubate on the benchtop for 30 mins.
4. Put on ice and proceed to the transformation.
''' Transformation by Heat-shock '''
1. Thaw a 200uL aliquot of cells on ice.
2. Add 50uL of water to the cells.
3. Add 30uL of KCM to the cells.
4. Put your ligation mixture on ice, let cool a minute or two.
5. Add 70uL of the cell cocktail to the ligation, stir to mix.
6. Let sit on ice for 10 min.
7. Heat shock for 90 seconds at 42°C.
8. Put back on ice for 1 min.
9. Add 100uL of 2YT.
10. Plate 70+uL on ampicillin, let incubate at 37°C overnight.
== March 19, 2013 ==
== March 19, 2013 ==


Line 19: Line 382:
7. Spin for 90 seconds, full speed to dry.
7. Spin for 90 seconds, full speed to dry.


8. Elute with water into a fresh Eppendorf tube
8. Elute with 8uL of water into a fresh Eppendorf tube
 
'' Today, I only performed the gel purification so that people who are behind could catch up. We will perform ligation and transformation together as a class next time. ''


''Stop here and perform ligation next time''


== March 14, 2013 ==
== March 14, 2013 ==
[[Image:2013_03_13-JCA-gel1.jpg | 200px ]]<br>
'' The gel is of the PCA2 products for the synthons. The first lane is the His-tag part's IPCR product, the second lane is the molecular weight standards, and the tenth lane is my PCA2 product. It looks good and I can proceed to zymo cleanup. ''


''' Zymo Cleanup of Amplification Reaction '''
''' Zymo Cleanup of Amplification Reaction '''
Line 71: Line 440:
5. Heat at 55°C, vortex until the gel has dissolved.
5. Heat at 55°C, vortex until the gel has dissolved.


'' This is an acceptable stopping point. Proceed with Zymo gel purification next time. ''
'' After performing zymo cleanup of the amplification reaction, I proceeded to EcoRI/BamHI digest of my product. I ran an agarose gel, cut out the appropriate bands, and dissolved the gel in an Eppendorf tube. I will continue with the gel purification steps next time. ''




Line 129: Line 498:


(456 bp)
(456 bp)
'' Today, I performed a zymo cleanup of the PCA1 product following the procedures enumerated above. Then, I set up the assembly for PCA2 reaction and handed over the tubes to the instructor for PCA2 protocol. ''




Line 163: Line 534:


(456 bp)
(456 bp)
'' Today, I just setup the assembly for PCA1 and handed over the PCR tube to the instructor for PCA1 protocol. ''





Latest revision as of 09:32, 16 May 2013

May 2, 2013

Today, we did the mapping of the pG001-Faccomt vector again and ran the gel. However, none of the plasmids gave the right band sizes.


April 30, 2013

My partner ligated the synthons, did the vector digest, and did the transformation and picked 6 white colonies from the plate over the weekend. After that, he picked the colonies and grew them in LB+CM and miniprepped the pGG001-Faccomt vectors. Today we are going to try to map the pG001-Faccomt vector with BsaI using the following protocol:


1. Map the 6 candidates with BsaI

8 uL ddH2O

1uL Miniprepped plasmid

1uL 10x NEB Buffer 2

0.5uL BsaI

2. Run the gel.


The bands were very faint. We should try running the gel again in the next lab


April 25, 2013

Colonies were picked by the instructor the day before, but no colonies were grown. So I checked the sequence of the synthons again and confirmed that the synthons can be assembled together and inserted into GG01 vector. Therefore, I decided to run a BsmB1 digest and perform gel purification. Then, I am going to carry out a golden gate assembly. First, the digest was setup and performed using the following procedure:


1uL NEB buffer 3

1uL per construct

0.5uL BsmB1

5.5uL ddH2O

Then, incubate in thermocycler at 55°C for 1 hour.


April 23, 2013

Today I am performing transformation process again to see if I can obtain some colonies this time. Again, the transformation was carried out using the following procedures.


Transformation by Heat-Shock

1. Thaw a 200 uL aliquot of cells on ice.

2. Add 20 uL of KCM to the cells.

3. Put your ligation mixture on ice, let cool a minute or two.

4. Add 70 uL of the cell cocktail to the ligation, stir to mix

5. Let sit on ice for 10 min.

6. Heat shock for 90 seconds at 42°C.

7. Put back on ice for 1 min.

8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.

9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.


April 19, 2013

The transformation failed and there were no colonies on the plate. So the golden gate was performed again using the following setup


4.5uL ddH2O

1uL Ligase buffer

0.5uL Ligase

0.5uL BsmB1

1uL per construct

0.5uL Vector


April 18, 2013

Transformation by Heat-shock

1. Thaw a 200 uL aliquot of cells on ice.

2. Add 20 uL of KCM to the cells.

3. Put your ligation mixture on ice, let cool a minute or two.

4. Add 70 uL of the cell cocktail to the ligation, stir to mix

5. Let sit on ice for 10 min.

6. Heat shock for 90 seconds at 42°C.

7. Put back on ice for 1 min.

8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.

9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.


April 16, 2013

Today, the sequencing data came in and I analyzed the data to choose the better clone of the two. I ended up choosing FaCCOMT-1A. Then, I performed a golden gate assembly using the following setup


4.5uL ddH2O

1uL Ligase buffer

0.5uL Ligase

0.5uL BsmB1

1uL per construct

0.5uL Vector


April 11, 2013

Miniprep

1. Pellet 2mL saturated culture by spinning full speed, 30 seconds in a 2mL Microcentrifuge tube. (Did it twice with 1mL tube)

2. Dump supernatant.

3. Add 250uL of P1 buffer into each tube. Resuspend the cells thoroughly.

4. Add 250uL of P2 buffer. Gently mix up and down. Solution should become clearer.

5. Add 350uL of N3 buffer. Slowly invert a few times, then shake.

6. Spin in centrifuge at top speed for 10 minutes.

7. Label blue columns with an alcohol-resistant lab pen.

8. Pour liquid into columns, and place the columns into the centrifuge. Spin at full speed for 15 seconds.

9. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin).

10. Wash each column with 500uL of PB buffer.

11. Spin in centrifuge at full speed for 15 seconds, then flick out the liquid again.

12. Wash with 750uL of PE buffer.

13. Spin in centrifuge at full speed for 15 seconds and flick out liquid again.

14. Spin in centrifuge at full speed for 90 seconds to dry off all water and ethanol.

15. Label new Microcentrifuge tubes and put columns in them.

16. Elute them by adding 50uL of water down the middle of the column (don't let it stick to the sides).

17. Spin in centrifuge at top speed for 30 seconds.

18. Take out columns and cap the tubes.

19. Clean up - note the P1 buffer is stored at 4°C and all the rest at room temperature.


Mapping

Setup:

6 uL ddH2O

2uL Miniprepped plasmid

1uL 10x NEB Buffer 2

0.5uL EcoRI

0.5uL XhoI


1. Incubate at 37°C for 30 minutes.

2. Run an analytical gel


April 9, 2013

This time, there are colonies on the plate. I can finally move on to picking of the colonies.


Picking of Colonies

1. Add 5mL of LB media with ampicilin to a clean test tube.

2. Pick a well-isolated, round, and "normal" looking colony with a micropipette tip.

3. Eject it in the test tube.

4. Incubate at 37°C overnight.


April 4, 2013

Today I am re-attempting ligation and transformation procedures to see if I can obtain colonies this time


Ligation of Eco/Bam Digests

Setup:

6.5uL ddH2O

1uL T4 DNA Ligase Buffer (small red or black-striped tubes)

1uL Vector digest

1uL Insert digest

0.5uL T4 DNA Ligase


Protocol:

1. Pound upside down on the bench to mix.

2. Give it a quick spin to send it back to the bottom of the tube.

3. Incubate on the benchtop for 30 mins.

4. Put on ice and proceed to the transformation.


Transformation by Heat-shock

1. Thaw a 200uL aliquot of cells on ice.

2. Add 30uL of KCM to the cells.

3. Put your ligation mixture on ice, let cool a minute or two.

4. Add 70uL of the cell cocktail to the ligation, stir to mix.

5. Let sit on ice for 10 min.

6. Heat shock for 90 seconds at 42°C.

7. Put back on ice for 1 min.

8. Add 100uL of 2YT.

9. Plate 170uL on ampicilin, let incubate at 37°C overnight.


I made a minor change to the procedure and omitted the addition of 50uL of water.


April 2, 2013

There were no colonies on the plate. There was a systematic error in the experiment, possibly during the ligation step. So I went back to the Eco/Bam digest step without running on gel and went straight to zymo cleanup using the following procedure.


Setup:

1. 8uL of eluted PCA2 product

2. 1uL of NEB Buffer 2

3. 0.5uL EcoRI

4. 0.5uL BamHI


Protocol:

1. Incubate at 37°C on the thermocycler for 1 hour.

2. Transfer into the Zymo column inside a collection tube.

3. Add 180uL of ADB buffer.

4. Spin through, discard waste.

5. Add 200uL of Zymo Wash Buffer.

6. Spin through, discard waste.

7. Add 200uL of Zymo Wash Buffer.

8. Spin through, discard waste.

9. Spin for 90 seconds, full speed to dry.

10. Elute with 8uL of water into a fresh Eppendorf tube.


We also ran the PCR digest on an agarose gel to see if there are bands. If there are no bands, it would indicate that we have lost our DNA during the zymo cleanup step. The gel was run using the following setup.


1. 1uL of PCR digest

2. 0.5uL of 6X loading dye


There were no bands in my lane, which implies that my DNA was lost somewhere along the step, possibly during zymo purification.


March 21, 2013

Ligation of EcoRI/BamHI Digests

Setup:

6.5uL ddH2O

1uL T4 DNA Ligase Buffer (small red or black-striped tubes)

1uL Vector digest

1uL Insert digest

0.5uL T4 DNA Ligase


Protocol:

1. Pound upside down on the bench to mix.

2. Give it a quick spin to send it back to the bottom of the tube.

3. Incubate on the benchtop for 30 mins.

4. Put on ice and proceed to the transformation.


Transformation by Heat-shock

1. Thaw a 200uL aliquot of cells on ice.

2. Add 50uL of water to the cells.

3. Add 30uL of KCM to the cells.

4. Put your ligation mixture on ice, let cool a minute or two.

5. Add 70uL of the cell cocktail to the ligation, stir to mix.

6. Let sit on ice for 10 min.

7. Heat shock for 90 seconds at 42°C.

8. Put back on ice for 1 min.

9. Add 100uL of 2YT.

10. Plate 70+uL on ampicillin, let incubate at 37°C overnight.


March 19, 2013

Zymo Gel Purification

Last time, I added ADB buffer and heated the gel at 55°C and vortexed it

1. Transfer into the Zymo column inside a collection tube.

2. Spin through, discard waste.

3. Add 200uL of Zymo Wash Buffer.

4. Spin through, discard waste.

5. Add 200uL of Zymo Wash Buffer.

6. Spin through, discard waste.

7. Spin for 90 seconds, full speed to dry.

8. Elute with 8uL of water into a fresh Eppendorf tube

Today, I only performed the gel purification so that people who are behind could catch up. We will perform ligation and transformation together as a class next time.


March 14, 2013


The gel is of the PCA2 products for the synthons. The first lane is the His-tag part's IPCR product, the second lane is the molecular weight standards, and the tenth lane is my PCA2 product. It looks good and I can proceed to zymo cleanup.


Zymo Cleanup of Amplification Reaction

1. Add 180uL of Zymo ADB buffer to a 50uL reaction.

2. Transfer into the Zymo column.

3. Spin through, discard waste.

4. Add 200uL of Zymo Wash Buffer.

5. Spin through, discard waste.

6. Add 200uL of Zymo Wash Buffer.

7. Spin through, discard waste.

8. Spin for 90 seconds, full speed to dry.

9. Elute with 50uL of ddH2O into a fresh Eppendorf tube.


EcoRI/BamHI Digest of PCR Product

Setup:

1. 8uL of eluted PCR product

2. 1uL of NEB Buffer 2

3. 0.5uL EcoRI

4. 0.5uL BamHI


Protocol:

1. Incubate at 37°C on the thermocycler for 1 hour.

2. Run an agarose gel.

3. Cut out appropriate bands minimizing extra gel matter.

4. Put in Eppendorf tube and add 600uL of Zymo ADB buffer.

5. Heat at 55°C, vortex until the gel has dissolved.

After performing zymo cleanup of the amplification reaction, I proceeded to EcoRI/BamHI digest of my product. I ran an agarose gel, cut out the appropriate bands, and dissolved the gel in an Eppendorf tube. I will continue with the gel purification steps next time.


March 12, 2013

Zymo Cleanup of PCA1

1. Add 180uL of Zymo ADB buffer to a 50uL reaction.

2. Transfer into the Zymo column.

3. Spin through, discard waste.

4. Add 200uL of Zymo Wash Buffer.

5. Spin through, discard waste.

6. Add 200uL of Zymo Wash Buffer.

7. Spin through, discard waste.

8. Spin for 90 seconds, full speed to dry.

9. Elute with 50uL of ddH2O into a fresh Eppendorf tube.


PCA2 Assembly of FaCCOMT-1

1uL each FaCCOMT-1_oligo_1 and FaCCOMT-1_oligo_7 (Made a 10uM dilution with 2uL of external oligo and 18uL of ddH2O)

1uL purified PCA product

0.5uL phusion

10uL 5x phusion buffer

5uL 2mM dNTPs

32.5uL ddH2O


PCA2 (Performed by instructor)

1. 2 min initial denature at 94°C

2. 30 sec denature at 94°C

3. 30 sec anneal at 60°C

4. 30 sec extension at 68°C

repeat 2-4 30 times total

Expected PCR product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGAAGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGTCTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCCAGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCCTGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTATTTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATTGTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

(456 bp)

Today, I performed a zymo cleanup of the PCA1 product following the procedures enumerated above. Then, I set up the assembly for PCA2 reaction and handed over the tubes to the instructor for PCA2 protocol.


March 8, 2013

PCA1 Assembly of FaCCOMT-1

38uL ddH2O

5uL 10x expand buffer

5uL 2mM dNTPs

1uL oligo mixture (100uM total, dilution prepared by instructor)

0.75uL Expand polymerase


PCA1 (Performed by instructor)

1. 2 min initial denature at 94°C

2. 30 sec denature at 94°C

3. 30 sec anneal at 55°C

4. 30 sec extension at 72°C

repeat 2-4 30 times total

Expected PCR product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGAAGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGTCTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCCAGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCCTGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTATTTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATTGTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

(456 bp)

Today, I just setup the assembly for PCA1 and handed over the PCR tube to the instructor for PCA1 protocol.


March 5, 2013

Construction File

Mix oligos (FaCCOMT-1_oligo_1-16) for one synthon, do PCA1 protocol        (456 bp, PCA1)

PCR PCA1 with FaCCOMT-1_oligo_1/FaCCOMT-1_oligo_7 by PCA2 protocol         (456 bp, PCA2)

Digest PCA2, gp                                                            (EcoRI/BamHI, 411+20+25 bp, pcrdig)
 
(get pre-digested vector from JCA of pBca9145-Bca1144)                     (EcoRI/BamHI, vectdig)
 
Ligate pcrdig and vectdig                                                  (pBca9145-FaCCOMT-1)


Oligos were assigned as follows:


FaCCOMT-1_oligo_1 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCACATCTTCATTCTTAG

FaCCOMT-1_oligo_2 AAGTCAGATGGTGACAAGAAAGAACCTGGACCAGCTTTAGCCATGATTTCCAAC

FaCCOMT-1_oligo_3 AAGTCCAATTCAATTGCTGCCTTTAAGACCATTGGTAAAACAGAGGCTGAGGCC

FaCCOMT-1_oligo_4 AATTGCATTGCAAACAAGTTAGCCTCTTCGTCTGAAACGTGTGTAGGAGTCATT

FaCCOMT-1_oligo_5 AGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGT

FaCCOMT-1_oligo_6 AGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCC

FaCCOMT-1_oligo_7 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCC

FaCCOMT-1_oligo_8 ATTCTGTCCAACATAACAGGAGCTTCAGGATTCTTAGTAGGTAATTGTGAGGCC

FaCCOMT-1_oligo_9 CTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCC

FaCCOMT-1_oligo_10 GGCAAAGTTCTTAATGAACAAGTCAAAATAGAGTAAGAAGCCAACAATCTCAAC

FaCCOMT-1_oligo_11 GTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCAT

FaCCOMT-1_oligo_12 TATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGA

FaCCOMT-1_oligo_13 TCAAGAATTTACAGACTGGACCCAAACAATACAATCTCTCTACTTTACCATCT

FaCCOMT-1_oligo_14 TGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTAT

FaCCOMT-1_oligo_15 TGTGTTTCACCGGTAGATCCCATCATAGGAGACCGATGAGACGATGCAGATCTC

FaCCOMT-1_oligo_16 TTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATT


Oligos were designed and prepared by Anderson Lab