Recipes & Protocols: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 66: Line 66:
===Gibson Assembly===
===Gibson Assembly===
*[https://www.neb.com/~/media/NebUs/Files/Feature%20Articles/Gibson_Assembly.pdf Introduction to Gibson assembly]
*[https://www.neb.com/~/media/NebUs/Files/Feature%20Articles/Gibson_Assembly.pdf Introduction to Gibson assembly]
*[http://2012.igem.org/Team:Freiburg/Project/Golden Golden Gate Clonning] (an alternative) (P: I never tried this one, but be my guest)  
*[http://2012.igem.org/Team:Freiburg/Project/Golden Golden Gate Cloning] (an alternative) (P: I've never tried this one before, but be my guest)  




  Compiled by '''Betül Kacar''' and '''Lily Tran''' in the year twothousandandthirteen.
  Compiled by '''Betül Kacar''' and '''Lily Tran''' in the year twothousandandthirteen.
  Please contact betul.kacar@biology.gatech.edu for questions.
  Please contact betul.kacar@biology.gatech.edu for questions.

Revision as of 21:48, 13 December 2013

Tools

Gene/Protein Info

Protocols

Primer designing for gene expression profiling (bacteria)

➢Get the gene name (eg: MYD88)

  • Go to NCBI (ncbi.nlm.nih.gov), and search in ‘Gene’ for the gene sequence.
  • Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
  • Click on the link and go to the gene description page.
  • Scroll down and clink on the link to find the CDS, or the RefSeq.
  • Copy the CDS sequence.
  • Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
  • All the parameters for optimal primers are usually preset. Do not change anything.
  • Click “pick primers’.
  • When the selection of primers comes up, choose a pair that is closest to the 3’ end.
  • Check the primer is 20bp long and the product size is between 150-200bp.
  • Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
  • Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
  • If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.

➢ Order primers through Invitrogen:

  • Purification: Desalted
  • Starting Synthesis Scale: 25nmole
  • Ship Medium: Dry
  • Normalization: None
  • Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221

➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)

Primers for Kan

  • Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
  • Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’

Site-Directed Mutagenesis

LTE Assays

araA Marker Test:

  • Make sure to have: HaeII Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck
  • araA marker revertant test

RT-PCR

Gibson Assembly


Compiled by Betül Kacar and Lily Tran in the year twothousandandthirteen.
Please contact betul.kacar@biology.gatech.edu for questions.