Recipes & Protocols: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Betul Kacar (talk | contribs) |
Betul Kacar (talk | contribs) |
||
| Line 66: | Line 66: | ||
===Gibson Assembly=== | ===Gibson Assembly=== | ||
*[https://www.neb.com/~/media/NebUs/Files/Feature%20Articles/Gibson_Assembly.pdf Introduction to Gibson assembly] | *[https://www.neb.com/~/media/NebUs/Files/Feature%20Articles/Gibson_Assembly.pdf Introduction to Gibson assembly] | ||
*[http://2012.igem.org/Team:Freiburg/Project/Golden Golden Gate | *[http://2012.igem.org/Team:Freiburg/Project/Golden Golden Gate Cloning] (an alternative) (P: I've never tried this one before, but be my guest) | ||
Compiled by '''Betül Kacar''' and '''Lily Tran''' in the year twothousandandthirteen. | Compiled by '''Betül Kacar''' and '''Lily Tran''' in the year twothousandandthirteen. | ||
Please contact betul.kacar@biology.gatech.edu for questions. | Please contact betul.kacar@biology.gatech.edu for questions. | ||
Revision as of 21:48, 13 December 2013
Tools
- Ensembl
- Primer3Plus
- USCS In-silico PCR
- IDT OligoAnalyzer
- Reverse complement
- GenoBase Keio
- DNA Restriction Site Analyzer
Gene/Protein Info
Protocols
Primer designing for gene expression profiling (bacteria)
➢Get the gene name (eg: MYD88)
- Go to NCBI (ncbi.nlm.nih.gov), and search in ‘Gene’ for the gene sequence.
- Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
- Click on the link and go to the gene description page.
- Scroll down and clink on the link to find the CDS, or the RefSeq.
- Copy the CDS sequence.
- Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
- All the parameters for optimal primers are usually preset. Do not change anything.
- Click “pick primers’.
- When the selection of primers comes up, choose a pair that is closest to the 3’ end.
- Check the primer is 20bp long and the product size is between 150-200bp.
- Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
- Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
- If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.
➢ Order primers through Invitrogen:
- Purification: Desalted
- Starting Synthesis Scale: 25nmole
- Ship Medium: Dry
- Normalization: None
- Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221
➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)
Primers for Kan
- Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
- Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’
Site-Directed Mutagenesis
LTE Assays
araA Marker Test:
- Make sure to have: HaeII Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck
- araA marker revertant test
RT-PCR
- BioRad Applications Guide
- Green RNA to CT of AB
- mirVana mRNA Isolation Kit
- A helpful tutorial by Margaret Hunt
- Dunham lab has some very helpful tips on microarray & genotyping studies
Gibson Assembly
- Introduction to Gibson assembly
- Golden Gate Cloning (an alternative) (P: I've never tried this one before, but be my guest)
Compiled by Betül Kacar and Lily Tran in the year twothousandandthirteen. Please contact betul.kacar@biology.gatech.edu for questions.