Recipes & Protocols: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Betul Kacar (talk | contribs) |
Betul Kacar (talk | contribs) |
||
| (39 intermediate revisions by 2 users not shown) | |||
| Line 5: | Line 5: | ||
*[http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer] | *[http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer] | ||
*[http://www.bioinformatics.org/sms/rev_comp.html Reverse complement] | *[http://www.bioinformatics.org/sms/rev_comp.html Reverse complement] | ||
*[http://ecoli.naist.jp/GB8-dev/index.jsp?page=gene_search.jsp&sf=T GenoBase Keio] | *[http://ecoli.naist.jp/GB8-dev/index.jsp?page=gene_search.jsp&sf=T GenoBase Keio] | ||
*[http://tools.neb.com/NEBcutter2/ DNA Restriction Site Analyzer] | |||
*[http://syntheticbiology.org/Tools.html A list of commonly used syntethic biology tools] by SyntheticBiology.org | |||
===Gene/Protein Info=== | ===Gene/Protein Info=== | ||
| Line 13: | Line 14: | ||
===Protocols=== | ===Protocols=== | ||
*[http://openwetware.org/wiki/Choosing_primers_for_qPCR Choosing primers for q-PCR] | *[http://openwetware.org/wiki/Choosing_primers_for_qPCR Choosing primers for q-PCR] | ||
*[http://openwetware.org/wiki/PCR_Overlap_Extension Soeing PCR - Primer design] | |||
===Primer designing for gene expression profiling (bacteria)=== | ===Primer designing for gene expression profiling (bacteria)=== | ||
| Line 47: | Line 49: | ||
===Site-Directed Mutagenesis=== | ===Site-Directed Mutagenesis=== | ||
*[http://www.aidsreagent.org/pdfs/pet15b.pdf pET15b map] | |||
*[http://www.chem.agilent.com/library/usermanuals/Public/210513.pdf QuikChange II STM Kit Protocol] | *[http://www.chem.agilent.com/library/usermanuals/Public/210513.pdf QuikChange II STM Kit Protocol] | ||
*[https://www.genomics.agilent.com/CollectionSubpage.aspx?PageType=Tool&SubPageType=ToolQCPD&PageID=15 QuikChange Primer Design (Agilent)] | *[https://www.genomics.agilent.com/CollectionSubpage.aspx?PageType=Tool&SubPageType=ToolQCPD&PageID=15 QuikChange Primer Design (Agilent)] | ||
=== LTE Assays=== | |||
araA Marker Test: | |||
*Make sure to have: ''Hae''II Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck | |||
*[http://barricklab.org/twiki/bin/view/Lab/ProtocolsAraMarker araA marker revertant test ] | |||
=== | ===RT-PCR=== | ||
*[http://www. | *[http://www.bio-rad.com/en-us/sku/170-9799-real-time-pcr-applications-guide BioRad Applications Guide] | ||
*[http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/PCR/real-time-pcr/real-time-pcr-reagents/one-step-real-time-rt-master-mix/power-sybr-rna-to-ct-1-step.html Green RNA to CT of AB] | |||
*[http://products.invitrogen.com/ivgn/product/AM1560 mirVana mRNA Isolation Kit] | |||
*A helpful [http://pathmicro.med.sc.edu/pcr/realtime-home.htm tutorial] by Margaret Hunt | |||
*[http://dunham.gs.washington.edu/protocols.shtml Dunham lab] has some very helpful tips on microarray & genotyping studies | |||
===Gibson Assembly=== | |||
*[https://www.neb.com/~/media/NebUs/Files/Feature%20Articles/Gibson_Assembly.pdf Introduction to Gibson assembly] | |||
*[http://2012.igem.org/Team:Freiburg/Project/Golden Golden Gate Cloning] (an alternative) (P: I've never tried this one before, but be my guest) | |||
*J5 [http://j5.jbei.org/bin/login.pl Primer design tool] | |||
---- | |||
: Compiled by Betül Kacar ''in the year twothousand''-thirteen. | |||
: Team members: Lily Tran and Jen Zhang | |||
: Contact betul_AT_gatech_DOT_edu for questions. | |||
Revision as of 23:51, 13 December 2013
Tools
- Ensembl
- Primer3Plus
- USCS In-silico PCR
- IDT OligoAnalyzer
- Reverse complement
- GenoBase Keio
- DNA Restriction Site Analyzer
- A list of commonly used syntethic biology tools by SyntheticBiology.org
Gene/Protein Info
Protocols
Primer designing for gene expression profiling (bacteria)
➢Get the gene name (eg: MYD88)
- Go to NCBI (ncbi.nlm.nih.gov), and search in ‘Gene’ for the gene sequence.
- Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
- Click on the link and go to the gene description page.
- Scroll down and clink on the link to find the CDS, or the RefSeq.
- Copy the CDS sequence.
- Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
- All the parameters for optimal primers are usually preset. Do not change anything.
- Click “pick primers’.
- When the selection of primers comes up, choose a pair that is closest to the 3’ end.
- Check the primer is 20bp long and the product size is between 150-200bp.
- Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
- Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
- If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.
➢ Order primers through Invitrogen:
- Purification: Desalted
- Starting Synthesis Scale: 25nmole
- Ship Medium: Dry
- Normalization: None
- Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221
➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)
Primers for Kan
- Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
- Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’
Site-Directed Mutagenesis
LTE Assays
araA Marker Test:
- Make sure to have: HaeII Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck
- araA marker revertant test
RT-PCR
- BioRad Applications Guide
- Green RNA to CT of AB
- mirVana mRNA Isolation Kit
- A helpful tutorial by Margaret Hunt
- Dunham lab has some very helpful tips on microarray & genotyping studies
Gibson Assembly
- Introduction to Gibson assembly
- Golden Gate Cloning (an alternative) (P: I've never tried this one before, but be my guest)
- J5 Primer design tool
- Compiled by Betül Kacar in the year twothousand-thirteen.
- Team members: Lily Tran and Jen Zhang
- Contact betul_AT_gatech_DOT_edu for questions.