IGEM:IMPERIAL/2006/project/primers/aiia: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
Jonny (talk | contribs)
No edit summary
 
(5 intermediate revisions by one other user not shown)
Line 4: Line 4:




'''We are using this primer'''
  ______________________ = RESTRICTION SITES
  ______________________ = RESTRICTION SITES
                       ___________________________ = Immuno TAG
                       ___________________________ = Immuno TAG
Line 24: Line 25:
  Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT
  Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT


There are no restriction sites for spe1 and pst1. The restriction sites can be cut by


Name Sequence SiteLength Overhang Frequency Cut Positions
'''There are no restriction sites for spe1 and pst1.'''
NaeI GCCGGC 6 blunt 1 9
AcyI GRCGYC 6 five_prime 1 2
BclI TGATCA 6 five_prime 1 15
Cfr10I RCCGGY 6 five_prime 1 7
SgrAI CRCCGGYG 8 five_prime 1 7
AatII GACGTC 6 three_prime 1 5
Hpy99I CGWCG 5 three_prime 1 7


'''The restriction sites can be cut by'''
Name Sequence SiteLength Overhang Frequency Cut Positions
NaeI GCCGGC           6 blunt 1 9
AcyI GRCGYC            6 five_prime 1 2
BclI TGATCA           6 five_prime 1 15
Cfr10I RCCGGY           6 five_prime 1 7
SgrAI CRCCGGYG   8 five_prime 1 7
AatII GACGTC           6 three_prime 1 5
Hpy99I CGWCG           5 three_prime 1 7


The primer should be
However none of these are complementary to any of the registary restriction enzymes so new primers must be ordered.


End of AiiA gene
'''Redisigning the primers'''
cgaaaactacgctttagtagcttaataaTACTAGTAGCGGCCGCTGCAG 3’
 
  Spe1 ------ pst1


Reverse and complement
End of desired AiiA gene


CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG
cgaaaactacgctttagtagcttaataaTACTAGTAGCGGCCGCTGCAG 3’
 
    Spe1   ------ pst1
 
'''Order the Reverse and complement'''
 
'''We are usin this primer'''
CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG
 
This should work
 
==Sequencing aiiA==
 
We are sequencing from the plasmid into the part in both directions, This should give us two overlapping sequences which we can align to get the full sequence of the promoters, RBS, Terminators and protein.
 
[[Image:Sequencing.JPG]]
 
 
[[User:JohnChattaway|JohnChattaway]] 12:36, 21 August 2006 (EDT)

Latest revision as of 15:12, 28 October 2006

We are trying to put a immuno tag onto aiia and these are the PCR primers which we think will work

The primer at the 5’ end of the coding strand is the same as the coding strand.


We are using this primer
______________________ = RESTRICTION SITES
                      ___________________________ = Immuno TAG
                                                 _____________________ = same as start of gene (ie. binds to - strand)
gaattcgcggccgcttctagagGATTATAAAGATGATGATGATAAAGGTatgacagtaaagaagctttat

This was orderd orrignally and is right

Problem

This Primer was ordered

_______________  = complemantary to end of gene (ie. binds to + strand)  
               _____________________ = RESTRICTION SITES (complementary to + sequence)
aatcatcgaattattatgatcatcgccggcgacgtc

This primer should be complementary to the coding strand so the coding strand made from this primer will be

Primer           aatcatcgaattattatgatcatcgccggcgacgtc
Sequence Created GACGTCGCCGGCGATGATCATAATAATTCGATGATT


There are no restriction sites for spe1 and pst1.

The restriction sites can be cut by 
Name	 Sequence 	SiteLength 	Overhang 	Frequency 	Cut Positions
NaeI 	GCCGGC 	           6 		blunt 			1 		9 
AcyI 	GRCGYC             6 		five_prime 		1		 2 
BclI 	TGATCA 	           6 		five_prime 		1		 15 
Cfr10I	RCCGGY 	           6 		five_prime 		1		 7 
SgrAI 	CRCCGGYG 	   8 		five_prime 		1		 7 
AatII 	GACGTC 	           6 		three_prime 		1		 5 
Hpy99I CGWCG 	           5 		three_prime 		1		 7

However none of these are complementary to any of the registary restriction enzymes so new primers must be ordered.

Redisigning the primers

End of desired AiiA gene

cgaaaactacgctttagtagcttaataaTACTAGTAGCGGCCGCTGCAG 3’
					  
			    Spe1	   ------ pst1

Order the Reverse and complement

We are usin this primer
CTGCAGCGGCCGCTACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCG

This should work

Sequencing aiiA

We are sequencing from the plasmid into the part in both directions, This should give us two overlapping sequences which we can align to get the full sequence of the promoters, RBS, Terminators and protein.


JohnChattaway 12:36, 21 August 2006 (EDT)