BME103:W930 Group10 l2: Difference between revisions
| (18 intermediate revisions by 6 users not shown) | |||
| Line 28: | Line 28: | ||
==Thermal Cycler Engineering== | ==Thermal Cycler Engineering== | ||
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto | Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Tito Jankowski and Josh Perfetto .<br> | ||
<center> | |||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:Pcrmachineplasticgroup10.jpg]] | [[Image:Pcrmachineplasticgroup10.jpg]] | ||
PCR Block | PCR Heating Block | ||
[[Image:Tray10.png]] | [[Image:Tray10.png]]</center> | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
PCR Block | <hr> | ||
<b>PCR Heating Block</b><br> | |||
The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. | The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. | ||
Heat Sink/Fan/etc | <b>Benefit and Function</b><br> | ||
The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate | |||
<b>Heat Sink/Fan/etc</b><br> | |||
These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. | These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. | ||
Benefit and Function | |||
<b>Benefit and Function </b> | |||
Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students. | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow, | In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow. Also, many of the pieces will be larger and easier to handle than previous designs. The materials will also be different, however they will have the same function. | ||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 72: | Line 77: | ||
'''Materials''' | '''Materials''' | ||
<!--- Place your two tables "Supplied in the | <!--- Place your two tables "Supplied in the Kit" and "Supplied by User" here ---> | ||
{| | {| | ||
| align="center" style="background:#f0f0f0;"|'''Supplied in Kit''' | | align="center" style="background:#f0f0f0;"|'''Supplied in the Kit''' | ||
| align="center" style="background:#f0f0f0;"|'''Amount''' | | align="center" style="background:#f0f0f0;"|'''Amount''' | ||
|- | |- | ||
| Line 104: | Line 109: | ||
| Open PCR||1 | | Open PCR||1 | ||
|- | |- | ||
| | | Epindorf Tubes||32 | ||
|- | |- | ||
| Pipettes|| | | Pipettes||10 | ||
|} | |} | ||
| Line 127: | Line 132: | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
<br> The PCR machine is color | <br> The PCR machine is color coded by row. Each group of students is assigned a color, up to eight groups. The groups will then set up the Open PCR on the computer, plug in the PCR machine and turn it on. Then, the students will put the DNA samples into the tubes via the pipettes, utilizing two different samples, a positive control, and a negative control. The students will then place their test tubes into their assigned colored row and the teacher will close the lid and start the program. Students will run this for two hours so that the PCR machine can amplify the DNA samples for 30-35 cycles, depending on the teacher's discretion and time constraints. | ||
Flourimeter Setup: <br> | Flourimeter Setup: <br> | ||
1. Place the glass slide onto the device.<br> | 1. Place the glass slide onto the device.<br> | ||
2. Turn on the blue light and move the slide | 2. Turn on the blue light and move the slide so that the light is positioned between two of the dots on the slide.<br> | ||
3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically '''not''' horizontally or side by side.<br> | 3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically '''not''' horizontally or side by side.<br> | ||
4. Place the phone in the holder close enough to the device to get a close picture.<br> | 4. Place the phone in the holder close enough to the device to get a close and accurate picture.<br> | ||
5. Place the box over the device and phone holder.<br> | 5. Place the box over the device and phone holder.<br> | ||
6. Close the box as much as possible and take picture. | 6. Close the box as much as possible and take a picture. | ||
'''DNA Measurement Protocol''' | '''DNA Measurement Protocol''' | ||
| Line 142: | Line 147: | ||
1. Open up the image. <br> | 1. Open up the image. <br> | ||
2. Go to Set Measurement under the tab analyze, and select area, integrated density, and mean grey value. After doing this once, the setting should remain the same. <br> | 2. Go to Set Measurement under the tab analyze, and select area, integrated density, and mean grey value. After doing this once, the setting should remain the same. <br> | ||
3. Split the channels, by going under the tab Image, and then Color. This will split the file into three files, one of which will be labeled as a green channel. <br> | 3. Split the channels, by going under the tab Image, and then select Color. This will split the file into three files, one of which will be labeled as a green channel. <br> | ||
4. Select the green image and then select the oval selection tool. <br> | 4. Select the green image and then select the oval selection tool. <br> | ||
5. Draw an oval around the droplet in the image and select Measure under the Analyze tab. <br> | 5. Draw an oval around the droplet in the image and select Measure under the Analyze tab. <br> | ||
| Line 167: | Line 172: | ||
Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br> | Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br> | ||
Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br> | Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br> | ||
Reverse Primer for Insomnia: <br> | Reverse Primer for Insomnia: <br> CTGAAAAAGGACACCGGAAAATGCACTGAGAAAGGCGAGTCCTTTGTCTGAGCCATACCC <br> | ||
Latest revision as of 23:31, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Tito Jankowski and Josh Perfetto . System Design PCR Heating Block ![]() Key Features PCR Heating Block Benefit and Function Heat Sink/Fan/etc Benefit and Function Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students. Instructions
ProtocolsMaterials
PCR Protocol
Flourimeter Setup: DNA Measurement Protocol ImageJ Procedure: Research and DevelopmentBackground on Disease Markers There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].
| |||||||||||||||||||||||||||||||||||||||||||||










