BME103:W930 Group1 l2: Difference between revisions
| (4 intermediate revisions by 3 users not shown) | |||
| Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:K_Chu.jpg|100px|thumb|Name: Kevin Chu<br>Experimemtal Protocol Planner]] | | [[Image:K_Chu.jpg|100px|thumb|Name: Kevin Chu<br>Experimemtal Protocol Planner]] | ||
| [[Image:Rodin_Thinker.JPG|100px|thumb|Name: Zhiyue Yang<br>Open PCR Machine Engineer]] | | [[Image:Rodin_Thinker.JPG|100px|thumb|Name: Zhiyue Yang<br>Open PCR Machine Engineer]] | ||
| Line 32: | Line 32: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:PCRLid.png|800x400px|]]<br> | [[Image:PCRLid.png|800x400px|]]<br> | ||
The picture shown above is the top of an Open PCR machine. This part consists of a LCD screen and a heating lid. The top of the machine has several issues. For example, the lid is hard to open. To solve these issues, we came up with several possible changes. | The picture shown above is the original top of an Open PCR machine. This part consists of a LCD screen and a heating lid. The top of the machine has several issues. For example, the lid is hard to open before the redesign. To solve these issues, we came up with several possible changes.<br> | ||
[[Image:NewPCR.jpg|600px]]<br> | |||
This picture show the redesigned Open PCR Machine complete with the modifications detailed below. | |||
'''Key Features'''<br> | '''Key Features'''<br> | ||
Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is extremely fragile and the wooden outside does not provide much durability. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only increase durability but also see the inner design of the machine easily. Last but not least, we can remove the knob which adjusts lid height. This knob ultimately makes the machine more confusing, as it is difficult to tell whether the lid is too high - causing the samples to receive less heat - too low - squishing the samples and potentially warping or damaging the test tubes the samples are in - or at the proper height. Instead, the lid will remain at the same height as long as the machine is closed and a specific test tube size will be standardized for the machine. | Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is extremely fragile and the wooden outside does not provide much durability. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only increase durability but also see the inner design of the machine easily. Last but not least, we can remove the knob which adjusts the heating lid height. This knob ultimately makes the machine more confusing, as it is difficult to tell whether the lid is too high - causing the samples to receive less heat - too low - squishing the samples and potentially warping or damaging the test tubes the samples are in - or at the proper height. Instead, the lid will remain at the same height as long as the machine is closed and a specific test tube size will be standardized for the machine. | ||
| Line 238: | Line 239: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:BME103_Group1_Heterotaxy_primer.jpg| | [[Image:BME103_Group1_Heterotaxy_primer.jpg|800px|Heterotaxy PCR primer design]] | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Latest revision as of 01:34, 30 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
Each DNA solution consists of
PCR Protocol
Research and DevelopmentBackground on Disease Markers Heterotaxy, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side. Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal. Forward primer sequence (position 136,651,203 – 136,651,223): 5'TCCCTGCGCAAACACATGAA3' Reverse primer sequence (200 base pairs to the right): 3'TCCCAACTTTGCTCACTCCC5' A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



