BME103:W930 Group5 l2: Difference between revisions
| (10 intermediate revisions by one other user not shown) | |||
| Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:Andrea2012.jpg|100px|thumb|Name: Andrea Carpenter<br>Role(s): Experimental Protocol Planner]] | | [[Image:Andrea2012.jpg|100px|thumb|Name: Andrea Carpenter<br>Role(s): Experimental Protocol Planner]] | ||
| [[Image:Photo_(1).JPG|100px|thumb|Name: Malik McLaurin<br>Role(s): Open PCR Machine Engineer]] | | [[Image:Photo_(1).JPG|100px|thumb|Name: Malik McLaurin<br>Role(s): Open PCR Machine Engineer]] | ||
| Line 28: | Line 28: | ||
'''System Design'''<br> | '''System Design'''<br><br> | ||
[[Image:PCR_labels.png|600x|]] | [[Image:PCR_labels.png|600x|]] | ||
This is the original system design, viewed with an open face from the side. The parts included in last weeks lab, along | This is the original system design, viewed with an open face from the side. The parts included in last weeks lab, along with the important parts included in this week's lab, are all diagramed. | ||
<br> | <br><br> | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
The following picture is a simple change in the design of the large exterior screw located on the top of the Open PCR lid: | The following picture is a simple change in the design of the large exterior screw located on the top of the Open PCR lid: | ||
| Line 40: | Line 40: | ||
The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them. | The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them. | ||
<br><br> | |||
Another change made on the machine was the hinge/lock of the heating lid: | |||
<br> | |||
[[Image:Side_lid.png]] | |||
<br> | |||
We removed the original locking mechanism (i.e. lid latch in diagram) and replaced it with two latches on both sides of the lid. The lid on the original Open PCR does not sit flush with the side of the machine, so the size of the lid will be expanded to fit the design. By changing the design of the latch, the lid will open much smoother and not require as much force. Also, by removing the difficult lock, the fear of breaking the Open PCR machine while opening the lid will diminish. By moving the latches to the side of the lid, room for a larger heating block is no longer obstructed, therefore the size of the heating block can be made larger and more samples can be tested. | |||
<br><br><br> | |||
Larger Heating Block: | |||
<br> | |||
[[Image:Heating_block.png|600px|]] | |||
<br> | |||
We expanded the heating block to fit 50 samples, instead of 16. The extra room for the heating block was accounted for in the lid design. By adding more room for samples to be tested, the user will save time in testing large numbers of samples because the machine is about 3 times more efficient. | |||
<br><br> | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
The instructions for setting up the new Open PCR machine will be almost identical to the original instructions. The original directions on how to install the lid lock will need to be omitted and replaced with directions on using the new latches. The new latches will come attached to the wooden exoskeleton of the PCR machine though, so the only instructions needed would be how to close the latches (which is basically self explanatory). Also, it should be included in the device's new instructions that the red line on the screw indicates when the screw is deep enough. Nothing needs to be changed on the directions of installing the new heating block, except possibly for the pictures to show 50 sample slots. | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Latest revision as of 01:39, 30 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. This is the original system design, viewed with an open face from the side. The parts included in last weeks lab, along with the important parts included in this week's lab, are all diagramed.
The screw itself was left unchanged, except for a red line marking how deep the screw should lie within the lid. With the original PCR design, there was no way to determine when the screw was in far enough until it was in too far, hitting the samples and possibly damaging them.
ProtocolsMaterials
(*)Positive control consists of calf thymus DNA Included in Fluorimeter Package:
Components of PCR master mix:
(*)Not actually included in kit, but must be added to the master mix by the user. Supplied by User
PCR Protocol
Research and DevelopmentBackground on Disease Markers For this experiment, our group chose to take an in-depth look at acute myeloid leukemia (AML). AML is a type of cancer that begins inside the bone marrow. The immune system of the human body is ultimately affected by AML, as bone marrow helps fight infections. The white blood cells that grow and form in bone marrow are turned into cancerous cells; the cells grow very quickly and sporadically, thus replacing healthy white blood cells. Our reference single nucleotide polymorphism associated with acute myeloid leukemia is rs121912500. In this SNP, the pathogenic allele for AML is classified as a single nucleotide variation. This means that only one nucleotide is altered in the allele causing AML. This variation results in a missense mutation. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121912500
Reverse primer sequence (while reading right to left, 3'-5', 200 coordinates/base pairs to the right): GCAAACAGCTCCTACCAGAC The diseased allele will give a PCR product because it will be amplified by using the created primers in the polymerase chain reaction. The non-disease allele will not give a PCR product because the primers are specifically coded for the disease-carrying allele containing the wrongfully inserted adenine.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





