BME103:T930 Group 11 l2: Difference between revisions
Tony Nguyen (talk | contribs) |
|||
| (10 intermediate revisions by 3 users not shown) | |||
| Line 44: | Line 44: | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
The same type of instructions to setting up the PCR | The same type of instructions to setting up the original PCR machine apply to this one; however, running the cycles will be quite different. There will no longer be a USB drive or cord that connect to a laptop. Now the actual readings and programs will all be on the touch-screen. So now you will be able to set up the machine very similarly as before except everything will be on the screen. The idea for the new PCR machine is to be more mobile and accessible to users. Setting up the cycling will all be the same with the same options as well, so there will not be any huge differences other than it will be less worry about connection to the laptop, which in turn equally reduces worry about portability. | ||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 170: | Line 170: | ||
Prostate Cancer: androgen receptor | Prostate Cancer: androgen receptor | ||
"Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. | "Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. In fact, the most common problem in almost all men as they grow older is an enlarged prostate. More information can be found regarding Prostate cancer is here.[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] | ||
An image of a normal prostate and cancer prostate[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/figure/A000380.B18038/?report=objectonly] | An image of a normal prostate and cancer prostate[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/figure/A000380.B18038/?report=objectonly] | ||
| Line 188: | Line 188: | ||
The DNA sequence is TCAAACGTGTTTTGATCAAAGAAGAG[G/T]AGTATGATTCTATTATAGTATTCTA | The DNA sequence is TCAAACGTGTTTTGATCAAAGAAGAG[G/T]AGTATGATTCTATTATAGTATTCTA | ||
[http://www.ncbi.nlm.nih.gov/snp?term=121913297] and in chromosome 13. | [http://www.ncbi.nlm.nih.gov/snp?term=121913297] and found in chromosome 13. | ||
'''Primer Design''' | '''Primer Design''' | ||
| Line 212: | Line 212: | ||
'''Illustration''' | '''Illustration''' | ||
These are the primers for the Retinoblastoma sample binding: | |||
[[Image:Retinoblastoma.jpg]] | |||
These are the primers for the Prostate Cancer sample binding: | |||
[[Image:Prostate Cancer.jpg]] | |||
This is the process of DNA amplification: | |||
http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif | http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif | ||
[http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif] | [http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif] | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:bayes.jpg]] | |||
<math>P(A|B) = \frac{P(B | A)\, P(A)}{P(B)}. \,</math><br> | |||
<math> P(A|B) </math> represents the probability that cancer will produce a positive outcome in the test (when the primer binds to the mutated gene). | |||
<math> P(B|A) </math> represents the probability a person will yield a positive result for the cancer test. | |||
<math> P(A) </math> represents the probability of carrying the mutated gene. | |||
<math> P(B) </math>represents the probability of people who would yield a positive result in the test without really having cancer. | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Latest revision as of 20:33, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||
OUR TEAM: Group 11LAB 2 WRITE-UPThermal Cycler EngineeringSystem Design Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. Our new design incorporates some new designs such as software, screen zize, number of testing tube lots, as well as size of heating lid. All of these alterations are made to make the Open PCR system more efficient in terms of its operating system and user-friendly features.
Our most major change to the Open PCR System is the change we made to the read-out screen on the top of the device near the heating lid. This change actually affects a few major components of our system. Not only did we move the screen to the side of the machine, rather than the top, but we also optimized the size of it. This size-change allows users to see the read-outs clearer. We also eliminated the need for a computer (or any outside device, that is) as this new larger screen will also be able to control the machine. Now the user is able to input cycles, temperature, etc. right on the screen instead of needing to plug it into a separate system. This allows for better portability and easier use. We also changed the space of the testing tubes so now more tubes can be tested at once. To do this we lengthened the plate as well as the heating lid entirely across the top of the machine. Removing the screen from this part of the Open PCR System also allowed for this change. Instructions
ProtocolsMaterials
PCR Protocol
DNA Measurement Protocol
Research and DevelopmentBackground on Disease Markers Prostate Cancer: androgen receptor "Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[1] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. In fact, the most common problem in almost all men as they grow older is an enlarged prostate. More information can be found regarding Prostate cancer is here.[2] An image of a normal prostate and cancer prostate[3] The marker that is being use was rs137852593.[4] The Dna Sequence is CTCTGCCTCTTCTTCTCCAGGCTTCC[G/T]CAACTTACACGTGGACGACCAGATG[5] and found in chromosome 13.
Retinoblastoma is a rare, cancerous tumor of a part of the eye called the retina. The disease is caused by a mutation in a gene controlling cell division, causing cells to grow out of control and become cancerous. The cancer generally affects children under the age of 6. It is most commonly diagnosed in children aged 1-2 years. The information regarding this disease is here.[6] An image of the eye is here. [7] The marker that is being use is rs121913297. [8] The DNA sequence is TCAAACGTGTTTTGATCAAAGAAGAG[G/T]AGTATGATTCTATTATAGTATTCTA [9] and found in chromosome 13. Primer Design Retinoblastoma Forward Primer: 5' ATCAAAGAAGAGTAGTATGA 3' There is a mutation from a G to a T Reverse Primer: 3' TAGTTTCTTCTCATCATACT 5' Prostate Cancer Forward Primer: 5' AGGCTTCCTCAACTTACACG 3' There is a mutation from a G to a T Reverse Primer: 3' TCCGAAGGAGTTGAATGTGC 5' If the sample carries the mutation, then the sample would test positive. If it does not, then the sample would test negative because the primers would not be able to bind to the DNA because it does not contain the proper sequence.
These are the primers for the Retinoblastoma sample binding: These are the primers for the Prostate Cancer sample binding: This is the process of DNA amplification: http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif [10]
[math]\displaystyle{ P(A|B) = \frac{P(B | A)\, P(A)}{P(B)}. \, }[/math] [math]\displaystyle{ P(A|B) }[/math] represents the probability that cancer will produce a positive outcome in the test (when the primer binds to the mutated gene). [math]\displaystyle{ P(B|A) }[/math] represents the probability a person will yield a positive result for the cancer test. [math]\displaystyle{ P(A) }[/math] represents the probability of carrying the mutated gene. [math]\displaystyle{ P(B) }[/math]represents the probability of people who would yield a positive result in the test without really having cancer.
|
||||||||||||||||||||||||||||










