BME103:T930 Group 13 l2: Difference between revisions
| (7 intermediate revisions by 2 users not shown) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| [[Image: | | [[Image:Billy.jpg|thumb|Name: Marcus Sansoni<br>Open PCR Machine Engineer]] | ||
| [[Image:Pete_Marple.jpg|100px|thumb|Name: Pete Marple<br>Open PCR Machine Engineer]] | | [[Image:Pete_Marple.jpg|100px|thumb|Name: Pete Marple<br>Open PCR Machine Engineer]] | ||
| [[Image:Michelle_Lipowicz.jpg|100px|thumb|Name: Michelle Lipowicz<br>Experimental Protocol Planner]] | | [[Image:Michelle_Lipowicz.jpg|100px|thumb|Name: Michelle Lipowicz<br>Experimental Protocol Planner]] | ||
| Line 58: | Line 58: | ||
{| class="wikitable" | {| class="wikitable" | ||
|- | |- | ||
| '''Supplied in Kit''' || '''Amount''' | |||
|- | |- | ||
| -PCR machine | | -PCR machine | ||
|- | |- | ||
| -Buffer || 3200 mL | | -Buffer || -3200 mL | ||
|- | |- | ||
| -Eppendorf || 12 | | -Eppendorf || -12 | ||
|- | |- | ||
| -Sybr green solution || | | -Sybr green solution || -Full Eppendorf tube | ||
|- | |- | ||
| -DNA calf thymus || 2 microg/mL (full Eppendorf tube) | | -DNA calf thymus || -2 microg/mL (full Eppendorf tube) | ||
|- | |- | ||
| -Pipettes || 20 | | -Pipettes || -20 | ||
|- | |- | ||
| -Glass slides || 5 | | -Glass slides || -5 | ||
|- | |- | ||
| -Black box | | -Black box | ||
|- | |- | ||
| -Buffer || 4000mL | | -Buffer || -4000mL | ||
|- | |- | ||
| -Master mix || 100 μL | | -Master mix || -100 μL | ||
|- | |- | ||
| -Phone holder | | -Phone holder | ||
| Line 100: | Line 100: | ||
<font size="4">'''PCR Protocol</font> | <font size="4">'''PCR Protocol</font> | ||
1. Transfer the PCR reaction mix (50 μL each tube cointaining Taq DNA polymerase, MgCl2, dNTP's, forward primer, reverse prime) into the micro-test tubes which will be used within the PCR machine. <br> | |||
2. Place up to 16 micro test into the PCR Machine and lower and lock the lid. <br> | |||
3. Run the open PCR program on a computer connected by usb to the PCR machine and set the cycles to: <br> | |||
Stage one: 1 cycle at 95 degrees Celsius for 3 minutes | |||
Stage two: 30 cycles at 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius for 30 seconds <br> | |||
Stage Three: 72 degrees Celsius for 3 minutes <br> | |||
Final Hold: 4 degrees Celsius <br> | |||
The program is very user friendly and is already pre-programmed so all you need for a basic PCR run is a power source. <br> | |||
The whole process will take about 3 hours to complete due to the amount of time it takes to transition from temperatures. <br> | |||
Latest revision as of 16:58, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||
THE A TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions ProtocolsMaterials
PCR Protocol 1. Transfer the PCR reaction mix (50 μL each tube cointaining Taq DNA polymerase, MgCl2, dNTP's, forward primer, reverse prime) into the micro-test tubes which will be used within the PCR machine.
Research and DevelopmentBackground on Disease Markers
Cystic fibrosis is a disease that can be passed on down genetically along the familial line. The disease causes a build up of thick mucus on the inside of the lungs, digestive tract and other parts of the body. Cystic Fibrosis is the most common chronic lung disease to effect children and young adults and is usually diagnosed by the age of two; however, there are weaker strains of the disease that often go un-diagnosed until the age of 18 or later. The disease is recessive so to suffer the disease one must have the gene from both parents. The disease is life-threatening, the mucus builds up and can eventually suffocate the victim. Around 1 in 29 Caucasians of middle European dissent suffer from cystic fibrosis, this is the most susceptible group to this disease. One such SNP which signals for a susceptibility to Cystic Fibrosis is the [A/G] swap changing the codon from TGG ⇒ TGA. This change has been recorded in two patients suffering from cystic fibrosis the swap occurs at nucleotide 302 in exon 3 converting codon 57 from TGG (trp) to TGA (stop). More information can be found: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121909025
The primers must be built around the sequence CGTCTCTAC[T/C]CTATCTCTC with the thymine swapped for the cytosine giving the primers: Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5' Forward primer: 5' AAATATCTGGCTGAGTGTTT 3' These primers are 150 bp apart so as to allow the PCR reaction to occur faster, shortening the 30 seconds required per temperature cycled to 10 seconds per cycle.
General PCR is very similar to our new version of PCR. The only difference is that our primers are only fifteen base pairs long and will be only 150 base pairs apart. So each copied segment in this illustration is 150 base pairs long and the primers look like the first illustration. | ||||||||||||||||||||||||






