User talk:Hossein Azari Soufiani: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 238: Line 238:




==Decision and inference Box. Nov 10th ==


With learning process I mean updating some parameters for a model. we can choose more parameters that can also choose one model among some models and the update that model. and this paparmeters dimension will grow bigger and bigger.
Two good properties that our decision process needs:
1) Flexible for adding a new model to check(Or flexible to add parameters)
2) Ability to update the parameters with just using a new experiment result(I mean it doesn't need all data again.)
For a given case study we can:
i)  Make our initial model space based on models that already exist for that case study.
ii)  Write a program to fit the data and find the goodness of fit for all the model and find the best model.(This can be done with methods like Maximum likelihood or just exhaustive search.)
iii) Use algorithms to design an updating approach using recursive estimation methods.(This can be done with Kalman filtering idea because we will have noise in our data.)


==December report for project ==
==December report for project ==

Revision as of 23:54, 19 March 2010

Report of Second Homework

The paper "Foundations for the Engineering Biology" was really interesting for me because I am an engineer and I like to see the problems from engineering point of view. The paper was written in a very classic engineering manner and it made understanding of our position in Bioengineering more clear for me.

Installing and preparing Python was very different than the other programs which I used before like Matlab, C++. I enjoyed using it, specially the object oriented programing ability makes it really powerful. Plot for Python is very similar to Matlab and we have same commands with a little bit difference. Here you see a plot for three different growth rates for exponential function plotted with different colors.

Code for Third Homework

import random import numpy as np

print print

Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg' RCCode=Code TempCode=Code

print 'Code=',Code print print


pro1=range(1,339) pro2=range(1,339) pro3=range(1,339) prom1=range(1,339) prom2=range(1,339) prom3=range(1,339)

  1. ----------------------Problem one --------------------------------------------


GCcontent=0 for i in range(0,len(Code)-1):

if Code[i]=='c': GCcontent=GCcontent+1 elif Code[i]=='g': GCcontent=GCcontent+1



print 'GC Content=',GCcontent print print print print

  1. ----------------------Problem two---------------------------------------------

for i in range(0,len(Code)-1):

if Code[len(Code)-1-i]=='c': RCCode=RCCode[:i]+'g'+RCCode[i+1:] if Code[len(Code)-1-i]=='g': RCCode=RCCode[:i]+'c'+RCCode[i+1:] if Code[len(Code)-1-i]=='t': RCCode=RCCode[:i]+'a'+RCCode[i+1:] if Code[len(Code)-1-i]=='a': RCCode=RCCode[:i]+'t'+RCCode[i+1:]

print 'Recerse Complement=:', RCCode print print

  1. ----------------------Problem Three---------------------------------------------

Here we put the table That I didn't put because it doesn't look good!!!

for i in range(0,338):

Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2] Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]

pro1[i]=standard[Temp1] pro2[i]=standard[Temp2] pro3[i]=standard[Temp3]

Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2] Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3] Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]

prom1[i]=standard[Temp1] prom2[i]=standard[Temp2] prom3[i]=standard[Temp3]


print 'Sequence of (+1) frame' print pro1

print 'Sequence of (+2) frame' print pro2

print 'Sequence of (+3) frame' print pro3

print 'Sequence of (-1) frame' print prom1

print 'Sequence of (-2) frame' print prom2

print 'Sequence of (-3) frame' print prom3


  1. -----------------------------Problem Four---------------------------

counter=0 for j in range(0,1000):

       Code=TempCode
       for i in range(0,10):
               Te=random.random()
               Te=np.fix(100*Te)
               Te2=random.random()
               Te2=int(np.fix(10*Te2))%3
               
               


               if   (Code[100*i+int(Te)]=='c') and (Te2==1):
                     Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
                     
               
               
               elif   (Code[100*i+int(Te)]=='c') and (Te2==2):
                     Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]


               elif   (Code[100*i+int(Te)]=='c') and (Te2==0):
                     Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]



               elif   (Code[100*i+int(Te)]=='t') and (Te2==1):
                     Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
               
               
               elif   (Code[100*i+int(Te)]=='t') and (Te2==2):
                     Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]


               elif   (Code[100*i+int(Te)]=='t') and (Te2==0):
                     Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]



               elif   (Code[100*i+int(Te)]=='g') and (Te2==1):
                     Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
               
               
               elif   (Code[100*i+int(Te)]=='g') and (Te2==2):
                     Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]


               elif   (Code[100*i+int(Te)]=='g') and (Te2==0):
                     Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]



               elif   (Code[100*i+int(Te)]=='a') and (Te2==1):
                     Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
               
               
               elif   (Code[100*i+int(Te)]=='a') and (Te2==2):
                     Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]


               elif   (Code[100*i+int(Te)]=='a') and (Te2==0):
                     Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]



       pro21=range(1,339)
       pro22=range(1,339)
       pro23=range(1,339)



       for i in range(0,338):
               Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
               Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3]   
               Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
               pro21[i]=standard[Temp1]
               pro22[i]=standard[Temp2]
               pro23[i]=standard[Temp3]


       for i in range(0,len(pro21)-1):
               if   pro21[i]=='*' and pro1[i]!='*':
                       counter=counter+1
   

print 'Percent of Premature Termination=',counter,'/1000' print print

print 'Before Mutation:', pro1 print print

print 'After Mutation:', pro21

input()




December report for project

During this project we started from looking at the dogma of biological systems and we tried to discus on the evolutionary development.

After dividing into groups we as mathematical modeling started to look at a model which encompass the evolutionary notion of development in it. Basically it uses Control theory ideas to design a system which will use a feedback system which optimally will use the experiment results as much as possible.

After proposing our system and having discussion in the class we went forward to an numerical example. After discussions with biology group and infrastructure we got two examples as eye-color and height.

So far we are working on the logistic modeling and we will use this method on the results that infrastructure part will give us from online resources.

Details of our group discussion is on the wiki.

This was a very good initiative for bio processing for me and the way we started to understand the details of this evolving path and start to think together to overcome the problems.

Thanks George a lot for shedding light in this way for us and thanks Harris and Sasha for their helps.

With all the best, Hossein