BYU iGEM/Archive: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 3: Line 3:
==Parts Database==
==Parts Database==


[[../Notebook/Parts_Database|BYU iGEM Biological Parts Database]]
[[https://spreadsheets.google.com/spreadsheet/ccc?hl=en&key=tAVBWBda3ggmyLcxX5FH6dw&hl=en#gid=0|BYU iGEM Biological Parts Database]]


==Articles==
==Articles==

Revision as of 21:10, 2 May 2011

Parts Database

[iGEM Biological Parts Database]

Articles

Sequence Data

OxyR Binding domain on the mnth gene

Site 1: TTTTCGTAGTCATAATCCTGGTCTATCAGAGAAATCA Source: [1]

Site 2: CTATCAGAGAAATCACCACAATCCATTTAAATGAATT Source: [2]

SoxR Binding domain on the SoxS gene

Site 1: AATCGCTTTACCTCAAGTTAACTTGAGGAATTATACTCC [3]

E. coli Colon cancer detector

Thermosensors

That paper that Dr. Griffitts suggested

PDF with primer sequences

PDF with ΔTRS mutation sequences

Thermoswitch Sequence

Multiple Cloning Site Map

Click image to enlarge.

Useful ROS Transcription factor articles

Ecocyc.org (anything you want to know about E. coli

SoxR Sequence Info at NCBI

OxyR Sequence Info at NCBI

Redox-operated genetic switches: the SoxR and OxyR transcription factors (Review)

Techniques to isolate O2-sensitive proteins: [4Fe-4S-FNR as an example.]

A genetically encoded sensor for H2O2 with expanded dynamic range (OxyR with YFP)

Rapid in vivo screening system for anti-oxidant activity using bacterial redox sensor strains.

Cellular Defenses against Superoxide and Hydrogen Peroxide

AND Gate Articles

Logical "And" switch part from iGEM registry

Other Colon Cancer Articles

Detection of Gastric Cancer and Premalignant Lesions by Novel Marker Glycoprotein 87 Using Monoclonal Antibody Adnab-9

Colon Cancer biomarker (Lgr5 protein)

Redox signaling and gene control in the Escherichia coli soxRS oxidative stress regulon - A review

The Universal Character of the Tumor-Associated Antigen Survivin

Biomarkers for Early Detection of Colon Cancer

OxyR and Soxr Transcription Factors

Biomarkers

Parts that activate translation at 37°C -- for more parts, change the final 2 in URL to 3 or 9

Bio Thermometer 1 (youTube video)

Bio Thermometer 2

Carcinoembryonic antigen

Prostate-specific antigen

ROS is decreased in cancerous cells

Toolbox

Synthetic Biology Tools

Synthetic Biology and Engineering Rules

Synthetic Gene Circuit

Directed Evolution of a Genetic Circuit

Microbial Metabolism

Mathematical Modeling

Biology by Design

Inversion Recombinase Mechanisms

Design and Construction of a Double Inversion Recombination Switch for Heritable Sequential Genetic Memory

Schools for Synthetic Biology [4]

Potential Mechanisms