This picture illustrates the original design of the Open PCR machine showing inner mechanisms. As the image shows, this Open PCR machine primarily consists of 5 parts: the LCD screen, heated lid, heater, circuit board, and fan. While the machine is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws.
This picture illustrates the original design of the Open PCR machine showing inner mechanisms. As the image shows, this Open PCR machine primarily consists of 5 parts: the LCD screen, heated lid, heater, circuit board, and fan. While the machine is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws.
Name: Michael Dennison Experimental Protocol Planner
Name: Zhiyue Yang Machine Engineer
Name: Vanessa Barker Machine Engineer
Name: Student Role(s)
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design
This picture illustrates the original design of the Open PCR machine showing inner mechanisms. As the image shows, this Open PCR machine primarily consists of 5 parts: the LCD screen, heated lid, heater, circuit board, and fan. While the machine is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws.
Experimenting With the Connections
When we unplugged the LCD screen from the circuit board, the machine's screen stopped displaying. When we unplugged the white wire that connects the circuit board to the heated lid, the temperature reported by the machine dropped, suggesting that the machine had stopped controlling the temperature of the heated lid.
Test Run
Our group used machine #1. During our first test run on October 24, 2012, the PCR machine was connected to a laptop that contained the programming for thermal cycling. All of the tubes containing the DNA samples were placed into the tray, which was then placed into the Open PCR machine. During the amplification, the machine's fan was not functioning. Therefore, we could not complete the DNA replication. However, previously prepared DNA solutions were available, so we conducted the experiment with these samples instead.
Protocols
Polymerase Chain Reaction
How PCR Works
Polymerase chain reaction (PCR) is a process that amplifies minute quantities of DNA in order to obtain a sufficient number of samples for analysis. DNA is a useful health marker and can predict the likelihood that a patient has cancer. During PCR, the double helix structure is unzipped to expose the bases. DNA primer is added to the DNA solution and binds to the gene that causes cancer. Because a non-cancer gene has a different nucleotide sequence from the cancer gene, the primer will not be able to attach to the exposed bases, so the DNA cannot be amplified. DNA amplification involves a sequence of steps called thermal cycling.
Thermal Cycling
1. To separate complementary base pairs, the sample was heated at 95°C for two minutes.
2. During annealing, the temperature was decreased to 57°C to allow the specific primers to attach. This step usually lasts between 30 seconds and one minute.
3. During extension, the temperature is increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA, lengthening the synthetic strand.
4. To obtain a sufficient number of samples, the process was repeated 30 times.
Patient 1
Replicate 1
ID: 92336
Gender: Male
Age: 58
Patient 1
Replicate 2
ID: 92336
Gender: Male
Age: 58
Patient 1
Replicate 3
ID: 92336
Gender: Male
Age: 58
Patient 2
Replicate 1
ID: 44606
Gender: Male
Age: 47
Patient 2
Replicate 2
ID: 44606
Gender: Male
Age: 47
Patient 2
Replicate 3
ID: 44606
Gender: Male
Age: 47
Flourimeter Measurements
Flourimeter Assembly and Experiment Procedures
1. The box was assembled by removing the lid and unbuttoning one of its sides.
2. Then, the box was placed upside down onto the lid, and the unbuttoned flap was lifted up. This created a dark environment that would allow for accurate measurements of the fluorescence of SYBR green dye.
3. Sample A was pipetted onto the slide. Because the slide is superhydrophobic, a drop formed.
4. Then, the slide was placed on the fluorimeter and adjusted so that the light fluoresced through the sample.
5. The superhydrophobic slide and its stand were placed near the back of the dark interior of the box.
6. The cell phone stand was placed near the front of the box, and the smartphone was placed on the stand.
7. Both the cell phone and the hydrophobic slide were aligned in the middle of the box. Neither the phone nor the fluorimeter was moved after adjusting them.
8. Then, using the camera function on the smartphone, the photograph was taken of the sample.
9. Steps 3-8 were repeated with the remaining DNA samples.
ImageJ Procedure
1. When each photograph was taken, it was automatically saved into the memory of the smartphone.
2. After all of the photographs had been taken, all of the images were attached to an email and sent to a computer that operated the ImageJ program.
3. The email was received by the computer, and the file containing the image was downloaded by right-clicking on the file and opening with ImageJ.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067.
Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%.
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results
Sample
Integrated Density
DNA μg/mL
Conclusion
PCR: Water
9647140
0.0000
No Signal
PCR: Calf thymus DNA
54999590
2.0000
Positive
PCR: Negative Control
6549794
0.2382
No Signal
PCR: Positive Control
48651893
1.7692
Positive
PCR: Patient 1 ID 92336, rep 1
42249825
1.5364
Positive
PCR: Patient 1 ID 92336, rep 2
38240163
1.3906
Positive
PCR: Patient 1 ID 92336, rep 3
65596983
2.3854
Positive
PCR: Patient 2 ID 44606, rep 1
10866235
0.3951
No Signal
PCR: Patient 2 ID 44606, rep 2
16970600
0.6171
No Signal
PCR: Patient 2 ID 44606, rep 3
12971264
0.4717
No Signal
KEY
Sample = Each sample is a solution of amplified DNA obtained via PCR. The first four rows of the table display the water sample, calf thymus DNA, negative control, and positive control. Rows 5-7 show results for 3 replicates of patient 1, and rows 8-10 show 3 replicates of patient 2.
Integrated Density = Integrated Density (INTDEN) is a measurement of the mean gray value for a specific area. The INTDEN values in the table were calculated by determining the INTDEN of the drop and subtracting it from the INTDEN of the background.
DNA μg/mL = The concentration of DNA in each sample was calculated by multiplying each sample's INTDEN value by 2 and dividing by the INTDEN value of the calf thymus.
Conclusion = Each calculated DNA concentration was compared to the concentrations of both the negative and positive controls. The samples with concentrations closer to the negative result produced no signal while the samples with concentrations closer to the positive result produced a positive test for cancer.