Name: Katey Hemphill Role(s) Research and Design Scientist
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design
Description
The OpenPCR Machine creates many copies of a small strand of DNA. In order to duplicate these DNA strands the PCR Machine must use many different temperatures during denaturing, annealing and extension. Denaturing is where the two strands of DNA separate. Annealing is where the DNA primer binds to the separate strands. Extension is when Taq Polymerase copies the DNA strands.
Experimenting With the Connections
When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked.
When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed.
Test Run
The date the machine was used was on Thursday October 24th, 2012. We had machine number 13. The team's experience with the device was as follows:
Pro's:
Lightweight
Silent
User Friendly
Great Software (it was very easy to use)
Con's:
Took too long to complete its task
Needed a computer
Hard open the lid
Not Aesthetically Pleasing
Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.)
Protocols
Polymerase Chain Reaction
PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA.
The process includes the following steps:
1. Heat Denaturation: The heating of DNA to 95 degrees celsius allowed for the separation of the two strands of DNA. The nucleotides lose their base pair partners as the DNA is separated into a positive and a negative strand.
2. Annealing: The DNA now undergoes cooling of 57 degrees celsius to assist the process of annealing. Two primers are necessary for DNA replication as it's the primers that identify the specific targeted strand of DNA. Binding to the complementary sequence, the primers begin to produce the replication that's desired.
3. Extension: To finish off the first cycle of PCR, the temperature is once again raised to 72 degrees celsius. The enzyme Taq DNA polymerase then creates the new DNA strands by making each single strand now a double strand using the complementary sequences produced in annealing. The conclusion of these three steps is the production of two new DNA strands that are the replicate of the original strand.
PRC Master Mix Components:
- Bacterially derived Taq DNA polymerase
- dNTPs
- Magnesium Chloride
- Reaction buffers
Reagent
Volume
Template DNA (20ng)
0.2 uL
10 uM forward primer
1.0 uL
10 uM reverse primer
1.0 uL
GoTaq master mix
50.0 uL
dH2O
47.8 uL
Total Volume
100 uL
The Samples
There were eight samples that were ran PCR on during this experiment. This included a positive control cancer DNA template and a negative control without a DNA template.
Flourimeter Measurements
(Add your work from Week 3, Part 2 here)
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA.
The process includes the following:
1. Heat to 95 degrees C. This separates the complementary DNA strands
2. Cool to 57 degrees C. This allows the primers to bind to the DNA strand.
3. Heat to 72 degrees C. This allows Taq to extend the DNA copy
4. Repeat
A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially.
A SNP, or single nucleotide polymorphism, is a point mutation, meaning one nucleotide in a sequence is changed. This change is stable over many generations, and is present in at least 1% of the population. This makes the SNP ideal for a gene marker. The following sequence, rs17879961, was used as a primer for the cancerous gene
Cancer Sequence: AAACTCTTACACTGCATACA
Normal Sequence: AAACTCTTACATTGCATACA
the red C, specifically, makes the gene cancerous
The forward primer would be TTT because it matches AAA
The backward primer would be TGT because it matches ACA
Integrated Density = Integrated density means the sum of all the pixels in the selected area. To get this value we used background subtraction. Background subtraction is when the background area value is subtracted from the sample (DNA) area value.
DNA μg/mL = To calculate this we used The DNA Calf Thymus Integrated Density and DNA ug/ml, and the integrated Density of another sample. We set it up as a fraction and solved for x. (DNA Calf Thymus Integrated density)/(DNA Calf Thymus DNA ug/ml) = (Integrated density of a sample)/x.
Conclusion= If the result was positive it meant that DNA was present and the PCR reaction was successful. If the result was negative it meant that DNA was not present and the PCR reaction was not successful. This is what the positive and negative controls were designed to do. The positive control was meant to be successful and the negative control was not.