BME103:T130 Group 12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 235: Line 235:
{| {{table}}
{| {{table}}
|- style="background:#f0f0f0;"
|- style="background:#f0f0f0;"
| '''Sample Name''' || '''Background ID''' || '''Area''' || '''X''' || '''Y''' || '''W''' || '''H''' || '''Mean Pixel Value''' || '''Raw INTDEN''' || '''INTDEN'''
| '''Sample Name''' || '''Background ID''' || '''Area''' || '''X''' || '''Y''' || '''W''' || '''H''' || '''Mean Pixel Value''' || '''Raw INTDEN''' || '''INTDEN (if different)'''
|-
|-
| Water (drop) || 4 drops of Water || 40090 || 900 || 1617 || 243 || 210 || 86.83 || 3481003 || G6
| Water (drop) || 4 drops of Water || 40090 || 900 || 1617 || 243 || 210 || 86.83 || 3481003 || --
|-
|-
| Water (Background) || 4 drops of Water || F6 || G6 || F13 || G13 || F6 || G6 || F6 || G6
| Water (Background) || 4 drops of Water || 40090 || -- || -- || -- || -- || 11.641 || 466695 || --
|-
|-
| Calf Thymus DNA (drop) || 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA || 23060 || 765 || 1587 || 204 || 144 || 178.144 || 4107996 || G6
| Calf Thymus DNA (drop) || 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA || 23060 || 765 || 1587 || 204 || 144 || 178.144 || 4107996 || --
|-
|-
| Calf Thymus DNA (background) || 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA || F6 || G6 || F13 || G13 || F6 || G6 || F6 || G6
| Calf Thymus DNA (background) || 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA || 21712 || -- || -- || -- || -- || 13.897 || 301733 || --
|-
|-
| PCR: Negative Control (drop) || 2 drops of Sybr Green I & 2 drops of C- || 53988 || 873 || 1809 || 276 || 249 || 78.544 || 4240449 || G6
| PCR: Negative Control (drop) || 2 drops of Sybr Green I & 2 drops of C- || 53988 || 873 || 1809 || 276 || 249 || 78.544 || 4240449 || --
|-
|-
| PCR: Negative Control (background) || 2 drops of Sybr Green I & 2 drops of C- || F6 || G6 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Negative Control (background) || 2 drops of Sybr Green I & 2 drops of C- || 53988 || -- || -- || -- || -- || 13.293 || 717685 || --
|-
|-
| PCR: Positive Control (drop) || 2 drops of Sybr Green I & 2 drops of C+ || 42819 || 687 || 1656 || 249 || 219 || 136.836 || 5859196 || G6
| PCR: Positive Control (drop) || 2 drops of Sybr Green I & 2 drops of C+ || 42819 || 687 || 1656 || 249 || 219 || 136.836 || 5859196 || --
|-
|-
| PCR: Positive Control (background) || 2 drops of Sybr Green I & 2 drops of C+ || F7 || G7 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Positive Control (background) || 2 drops of Sybr Green I & 2 drops of C+ || F7 || G7 || F6 || G6 || F13 || G13 || F6 || --
|-
|-
| PCR: Patient 1 ID 11014, rep 1 (drop) || 2 drops of Sybr Green I & 2 drops of 1A || 32840 || 849 || 1626 || 258 || 165 || 230.513 || 7570053 || G6
| PCR: Patient 1 ID 11014, rep 1 (drop) || 2 drops of Sybr Green I & 2 drops of 1A || 32840 || 849 || 1626 || 258 || 165 || 230.513 || 7570053 || --
|-
|-
| PCR: Patient 1 ID 11014, rep 1 (background) || 2 drops of Sybr Green I & 2 drops of 1A || F8 || G8 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Patient 1 ID 11014, rep 1 (background) || 2 drops of Sybr Green I & 2 drops of 1A || F8 || G8 || F6 || G6 || F13 || G13 || F6 || --
|-
|-
| PCR: Patient 1 ID 11014, rep 2 (drop) || 2 drops of Sybr Green I & 2 drops of 2A || 24996 || 780 || 1674 || 204 || 156 || 194.658 || 4865678 || G6
| PCR: Patient 1 ID 11014, rep 2 (drop) || 2 drops of Sybr Green I & 2 drops of 2A || 24996 || 780 || 1674 || 204 || 156 || 194.658 || 4865678 || --
|-
|-
| PCR: Patient 1 ID 11014, rep 2 (background) || 2 drops of Sybr Green I & 2 drops of 2A || F9 || G9 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Patient 1 ID 11014, rep 2 (background) || 2 drops of Sybr Green I & 2 drops of 2A || F9 || G9 || F6 || G6 || F13 || G13 || F6 || --
|-
|-
| PCR: Patient 1 ID 11014, rep 3 (drop) || 2 drops of Sybr Green I & 2 drops of 3A || 34832 || 852 || 1743 || 231 || 192 || 232.768 || 8107782 || G6
| PCR: Patient 1 ID 11014, rep 3 (drop) || 2 drops of Sybr Green I & 2 drops of 3A || 34832 || 852 || 1743 || 231 || 192 || 232.768 || 8107782 || --
|-
|-
| PCR: Patient 1 ID 11014, rep 3 (background) || 2 drops of Sybr Green I & 2 drops of 3A || F10 || G10 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Patient 1 ID 11014, rep 3 (background) || 2 drops of Sybr Green I & 2 drops of 3A || F10 || G10 || F6 || G6 || F13 || G13 || F6 || --
|-
|-
| PCR: Patient 2 ID 46446, rep 1 (drop) || 2 drops of Sybr Green I & 2 drops of 1B || 62026 || 687 || 2013 || 342 || 231 || 173.954 || 10789693 || G6
| PCR: Patient 2 ID 46446, rep 1 (drop) || 2 drops of Sybr Green I & 2 drops of 1B || 62026 || 687 || 2013 || 342 || 231 || 173.954 || 10789693 || --
|-
|-
| PCR: Patient 2 ID 46446, rep 1 (background) || 2 drops of Sybr Green I & 2 drops of 1B || F11 || G11 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Patient 2 ID 46446, rep 1 (background) || 2 drops of Sybr Green I & 2 drops of 1B || F11 || G11 || F6 || G6 || F13 || G13 || F6 || --
|-
|-
| PCR: Patient 2 ID 46446, rep 2 (drop) || 2 drops of Sybr Green I & 2 drops of 2B || 96912 || 789 || 1797 || 252 || 237 || 162.36 || 7616625 || G6
| PCR: Patient 2 ID 46446, rep 2 (drop) || 2 drops of Sybr Green I & 2 drops of 2B || 96912 || 789 || 1797 || 252 || 237 || 162.36 || 7616625 || --
|-
|-
| PCR: Patient 2 ID 46446, rep 2 (background) || 2 drops of Sybr Green I & 2 drops of 2B || F12 || G12 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Patient 2 ID 46446, rep 2 (background) || 2 drops of Sybr Green I & 2 drops of 2B || F12 || G12 || F6 || G6 || F13 || G13 || F6 || --
|-
|-
| PCR: Patient 2 ID 46446, rep 3 (drop) || 2 drops of Sybr Green I & 2 drops of 3B || 40980 || 771 || 1734 || 252 || 207 || 122.754 || 5030472 || G6
| PCR: Patient 2 ID 46446, rep 3 (drop) || 2 drops of Sybr Green I & 2 drops of 3B || 40980 || 771 || 1734 || 252 || 207 || 122.754 || 5030472 || --
|-
|-
| PCR: Patient 2 ID 46446, rep 3 (background) || 2 drops of Sybr Green I & 2 drops of 3B || F13 || G13 || F6 || G6 || F13 || G13 || F6 || G6
| PCR: Patient 2 ID 46446, rep 3 (background) || 2 drops of Sybr Green I & 2 drops of 3B || F13 || G13 || F6 || G6 || F13 || G13 || F6 || --
|}
|}



Revision as of 05:34, 15 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Justin Landstrom
Experimental Protocol Planner and ImageJ Software Processor
Name: Chiao May Lee
Experimental Protocol Planner and Data Compiler and Analyzer
Name: James Kyeh
Open PCR Machine Engineer and DNA Measurement Operator
Name: Jakob G. Wells
R&D Scientist
Name: Heidi Hall
Open PCR Machine Engineer and Protocol Person
Name: student
Role(s)

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design

The Open PCR machines is a DYI device that is composed of many circuit boards, wires, and a wooden frame. It is to be used to cycle DNA by oscillating the temperature of the DNA samples. This machine predominately works when the samples are placed in the main heating block, at which point a heated lid is placed down on top of the samples. Once the software for this Open PCR device is set up, the temperature change and the actual process begins. Within the Open PCR machine is a multitude of parts that keep the machine intact. These parts include a heat sink and fan to absorb heat, a circuit board that runs all the parts, a power supply to maintain the electricity, and a LCD display to show the user information. In conclusion, all of these parts work cohesively to generate this working machine known as the Open PCR.

Experimenting With the Connections
It is important to note that the LCD display will not work if it is not connected to the Open PCR circuit Board. Also, the temperature will not be shown on the LCD display if the white wire connecting to the main heating block is disconnected from the Open PCR circuit board.

Test Run The test run was done November 1st, 2012. Machine number 12 was used and there were minimal problems. It felt as if the machine was running slower than it should, but other than that all went well.



Protocols

Polymerase Chain Reaction

A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA.


Steps to Amplify a Patient's DNA Sample

1. PCR uses controlled temperature changes to make copies of DNA. Heat (about 95°C) separates double-stranded DNA into two single strands; this process is called denaturation.

2. "Primers", or short DNA strands, binds to the very end of the complimentary sequence that is being replicated. This step is called annealing, which takes place between 40°C and 65°C. The temperature that we used was 57°C.

3. Once the annealing process is done, the temperature is raised to about 72°C and DNA polymerase then extends from the primers copying the DNA.

4. PCR then amplifies a segment of a DNA sequence. In the end, there will be two new DNA strands identical to the original strand.


Components of PCR Master Mix

• A modified form of the enzyme Taq DNA polymerase that lacks 5´→3´ exonuclease activity.

• dNTPs

• MgCl2

• Colorless Reaction Buffer (pH 8.5)


Components of PCR Master Mix

Reagent Volume
Template DNA (20 ng) 0.2μL
10μM forward primer 1.0μL
10μM reverse primer 1.0μL
GoTaq master mix 50.0μL
dH2O 47.8μL
Total Volume 100μL


Sample 1: Patient ID: 11014 Age: 67 Gender: Male Replicate: 1

Sample 2: Patient ID: 11014 Age: 67 Gender: Male Replicate: 2

Sample 3: Patient ID: 11014 Age: 67 Gender: Male Replicate: 3

Sample 4: Patient ID: 46446 Age: 62 Gender: Female Replicate: 1

Sample 5: Patient ID: 46446 Age: 62 Gender: Female Replicate: 2

Sample 6: Patient ID: 46446 Age: 62 Gender: Female Replicate: 3

Sample 7: Positive Control

Sample 8: Negative Control


Flourimeter Assembly Procedure

1. To assemble the flourimeter, first obtain smartphone to capture the picture needed during data collection.

2. Turn on the flourimeter and drop a single drop of solution onto the hydrophobic slide.

3. Turn the black box provided upside down to cover the flourimeter.

4. Set up the smartphone on the stand provided, and align the camera/phone about 3 inches in front of the flourimeter. Make sure that the stand and the flourimeter is covered directly under the black box.


Proper assembly of the flourimeter.


Steps To Prepare Samples For The Flourimeter

You will have 8 samples from the OpenPCR instrument and 1 DNA (calf thymus standard at 2 micrograms/mL) sample and water from the scintillation vial to analyze.

1. With a permanent marker, number your transfer pipettes at the bulbs so that you only use if for one sample. With the permanent marker number your Eppendorf tubes at the top. At the end, you should have 10 Eppendorf tubes and 10 pipettes clearly labeled.

2. Transfer each sample seperatly (using one pipette per sample) into an Eppendorf tube containing 400 mL of buffer. Label this tube with the number of your sample. Get your entire sample into this Eppendorf tube. You can use this sample number transfer pipette to place only this sample drop onto the fluorescent measuring device.

3. Take the specially labeled Eppendorf tube containing Sybr Green I using the specifically labeled pipette only place two drops on the first two centered drops as seen on the video.

4. Now take your diluted sample and place two drops on top of the Syber Green I solution drops.

5. Align the light going through the drop, as seen in the video.

6. Let the smart-phone operator take as many pictures using the light box as he/she wants.

7. Now either rerun the sample again or discard that sample’s pipette. Keep the Sybr Green I labeled pipette.

8. You can run 5 samples per glass slide.

9. As the last sample run the water from the scintillation vial as a blank using the same procedure as with the other samples.


Procedure for Capturing Images of the Flourimeter with a Smartphone

Our group used a Galaxy Nexus

1. After setting up the Flourimeter set a Smartphone’s photo settings to the ones listed.

  1. Inactivate the flash
  2. Set ISO To 800 (or higher if possible)
  3. Set White Balance to Auto
  4. Set Exposure to Highest Setting
  5. Set Saturation to the Highest Setting
  6. Set Contrast to Lowest Setting

2. Once the samples have been prepared, place the Flourimeter in the light box.

3. Take as many pictures as needed. Your goal is to take pictures clear enough so ImageJ can take data from the images.

4. Once you have taken enough photos of that sample give the Flourimeter back to the sample preparer to prepare the next sample.

5. Repeat this procedure for all the samples.


A pure drop of water on the hydrophobic slide


Procedure for Opening Images in ImageJ

1. ImageJ was used to analyze the images taken by the smartphone. To upload the image onto ImageJ, the ANALYZE tab was clicked and SET MEASUREMENTS was chosen. AREA INTEGRATED DENSITY and MEAN GREY VALUE was selected from the menu.

2. The MENU tab was selected and COLOR was chosen, the function SPLIT CHANNELS was used; three separate files were created. SYBR GREEN fluoresces green, so the image name with "green" next to it was used.

3. The oval selection was used to draw an oval around the green drop. Then, MEASURE was selected from the ANALYZE tab, and the sample number and the numbers measured from the image was recorded.

4. To get the readings from the background of the image, another oval of the same size was drawn in the green image and MEASURE was selected from ANALYZE tab. The sample number and the numbers measured from the image was recorded, this data will be labeled as "background".

5. The measurements were saved in an excel file by clicking SAVED AS from the FILE tab.



Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT(The letters in the sequence are the bases and stand for Guanine (G), Adenine (A), Cytosine (C), and Thymine (T). ) will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach because the sequence is AACTCTTACACTTCGATACAT, and there will be no DNA signal. The primer sequences that will be used is ACTC or in reverse CTCA.

A positive result will be known because there will be a profound amount of the same sequence, the r17879961. If there is none of the sequence than we know that the results are negative.


http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png

Baye's Law (worksheet)

Basically Baye's Rule is that the results are not 100% accurate. Therefore, there will be some incorrect results. False positives and false negatives can occur often. Baye's Rule is what is used to find the false positive and false negative results. [IMG]http://i.imgur.com/XwQGA.png[/IMG] Source: http://openpcr.org/use-it/



Results

Sample Name Background ID Area X Y W H Mean Pixel Value Raw INTDEN INTDEN (if different)
Water (drop) 4 drops of Water 40090 900 1617 243 210 86.83 3481003 --
Water (Background) 4 drops of Water 40090 -- -- -- -- 11.641 466695 --
Calf Thymus DNA (drop) 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA 23060 765 1587 204 144 178.144 4107996 --
Calf Thymus DNA (background) 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA 21712 -- -- -- -- 13.897 301733 --
PCR: Negative Control (drop) 2 drops of Sybr Green I & 2 drops of C- 53988 873 1809 276 249 78.544 4240449 --
PCR: Negative Control (background) 2 drops of Sybr Green I & 2 drops of C- 53988 -- -- -- -- 13.293 717685 --
PCR: Positive Control (drop) 2 drops of Sybr Green I & 2 drops of C+ 42819 687 1656 249 219 136.836 5859196 --
PCR: Positive Control (background) 2 drops of Sybr Green I & 2 drops of C+ F7 G7 F6 G6 F13 G13 F6 --
PCR: Patient 1 ID 11014, rep 1 (drop) 2 drops of Sybr Green I & 2 drops of 1A 32840 849 1626 258 165 230.513 7570053 --
PCR: Patient 1 ID 11014, rep 1 (background) 2 drops of Sybr Green I & 2 drops of 1A F8 G8 F6 G6 F13 G13 F6 --
PCR: Patient 1 ID 11014, rep 2 (drop) 2 drops of Sybr Green I & 2 drops of 2A 24996 780 1674 204 156 194.658 4865678 --
PCR: Patient 1 ID 11014, rep 2 (background) 2 drops of Sybr Green I & 2 drops of 2A F9 G9 F6 G6 F13 G13 F6 --
PCR: Patient 1 ID 11014, rep 3 (drop) 2 drops of Sybr Green I & 2 drops of 3A 34832 852 1743 231 192 232.768 8107782 --
PCR: Patient 1 ID 11014, rep 3 (background) 2 drops of Sybr Green I & 2 drops of 3A F10 G10 F6 G6 F13 G13 F6 --
PCR: Patient 2 ID 46446, rep 1 (drop) 2 drops of Sybr Green I & 2 drops of 1B 62026 687 2013 342 231 173.954 10789693 --
PCR: Patient 2 ID 46446, rep 1 (background) 2 drops of Sybr Green I & 2 drops of 1B F11 G11 F6 G6 F13 G13 F6 --
PCR: Patient 2 ID 46446, rep 2 (drop) 2 drops of Sybr Green I & 2 drops of 2B 96912 789 1797 252 237 162.36 7616625 --
PCR: Patient 2 ID 46446, rep 2 (background) 2 drops of Sybr Green I & 2 drops of 2B F12 G12 F6 G6 F13 G13 F6 --
PCR: Patient 2 ID 46446, rep 3 (drop) 2 drops of Sybr Green I & 2 drops of 3B 40980 771 1734 252 207 122.754 5030472 --
PCR: Patient 2 ID 46446, rep 3 (background) 2 drops of Sybr Green I & 2 drops of 3B F13 G13 F6 G6 F13 G13 F6 --


Sample INTDEN (drop) INTDEN (background) INTDEN with Background Subtracted DNA μg/mL Conclusion
Water E6 F6 3014308 None
Calf Thymus DNA E6 F6 3806263 2.0
PCR: Negative Control E6 F6 3522764 1.9
PCR: Positive Control E7 F7 5354332 2.8
PCR: Patient 1 ID 11014, rep 1 E8 F8 7225141 3.8
PCR: Patient 1 ID 11014, rep 2 E9 F9 4609127 2.4
PCR: Patient 1 ID 11014, rep 3 E10 F10 7665341 4
PCR: Patient 2 ID 46446, rep 1 E11 F11 10039650 4.3
PCR: Patient 2 ID 46446, rep 2 E12 F12 6939049 3.6
PCR: Patient 2 ID 46446, rep 3 E13 F13 4517008 2.4


KEY

  • Sample =
  • Rep = Repeat
  • Drop = The values obatined when you draw the best oval around the (green) drop image and then select ANALYZE > MEASURE
  • Background = The values obtained when you draw another oval of the same size in the (green) file for the background above the drop to get the “noise," and select ANALYZE > MEASURE
  • INTDEN = Integrated Density
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =