BME103:T130 Group 3: Difference between revisions
| Line 48: | Line 48: | ||
'''Polymerase Chain Reaction'''<br> | '''Polymerase Chain Reaction'''<br> | ||
1.The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. <br> | 1.)The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. <br> | ||
2. They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. <br> | 2.) They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. <br> | ||
3.They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. <br><br> | 3.)They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. <br><br> | ||
<b>GoTaq Mix Components For 100μl reaction volume:</b><br> | <b>GoTaq Mix Components For 100μl reaction volume:</b><br> | ||
Revision as of 04:53, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing
A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands. Experimenting With the Connections When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. Test Run We initially ran the test October 25, 2012 on machine number 9. The machine worked well and we had no problems with it.
ProtocolsPolymerase Chain Reaction 1.)The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. GoTaq Mix Components For 100μl reaction volume:
Patient 2
Image J Instructions
Research and DevelopmentThe Underlying Technology Polymerase Chain Reaction, also known as PCR, is used to reproduce or amplify specific sections of DNA. A PCR machine carries out this reaction synthetically. Components of a PCR reaction: Primer: A reagent that is artificially synthesized DNA sequence that binds specifically to the target sequence of the template DNA, in this case the sequence that is linked with cancer. If the target sequence is not present on the template DNA, then the primer will not bind and amplification will not occur. Taq Polymerase: This is an enzyme that drives DNA replication. Polymerase builds each single strand of DNA marked by a primer into a new, double-stranded DNA segment. It works by finding the ends of the primers, finding free nucleotides from an added solution, then it scans the template DNA to match the proper nucleotides and attaches these nucleotides with hydrogen bonds. The benefit of using Taq Polymerse is that it can withstand extreme temperatures and does not denature during the process of the PCR reaction. Magnesium Chloride: This compound is added to the reaction mixture and binds to the Taq Polymerase, it is used to help the reaction function smoothly and can be adjusted to control the speed of the reaction. dNTP’s: This is the mixture of free bases needed to combine to make new DNA strands that are the product of this reaction. During the thermal cycling three steps occur: This image illustrates the process described above: Specific Cancer Marker Detection The single nucleotide polymorphism (SNP), 17879961, that is being examined in this experiment is known to be linked with breast and colorectal cancer. The SNP is located on the 22nd chromosome and affects the gene checkpoint kinase 2. The sequence of this gene is:
Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Reliability (Baye's Rule) Equation: Conditional Probabilities ResultsPositive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O----------------
| |||||||||||||||||||||||||||||||||||||||||||||||||||






