BME103:T130 Group 13 l2: Difference between revisions
| Line 17: | Line 17: | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Ujwala Vaka<br>Experimental protocol planner]] | | [[Image:BME103student.jpg|100px|thumb|Name: Ujwala Vaka<br>Experimental protocol planner]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Emily Herring<br>Experimental protocol planner]] | | [[Image:BME103student.jpg|100px|thumb|Name: Emily Herring<br>Experimental protocol planner]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Sudarshan Iyer<br>Research and | | [[Image:BME103student.jpg|100px|thumb|Name: Sudarshan Iyer<br>Research and Development scientist]] | ||
|} | |} | ||
Revision as of 17:02, 16 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers Cystic fibrosis is a disease that can be passed on down genetically along the familial line. The disease causes a build up of thick mucus on the inside of the lungs, digestive tract and other parts of the body. Cystic Fibrosis is the most common chronic lung disease to effect children and young adults and is usually diagnosed by the age of two; however, there are weaker strains of the disease that often go un-diagnosed until the age of 18 or later. The disease is recessive so to suffer the disease one must have the gene from both parents. The disease is life-threatening, the mucus builds up and can eventually suffocate the victim. Around 1 in 29 Caucasians of middle European dissent suffer from cystic fibrosis, this is the most susceptible group to this disease. One such SNP which signals for a susceptibility to Cystic Fibrosis is the [A/G] swap changing the codon from TGG ⇒ TGA. This change has been recorded in two patients suffering from cystic fibrosis the swap occurs at nucleotide 302 in exon 3 converting codon 57 from TGG (trp) to TGA (stop). More information can be found: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121909025
The primers must be built around the sequence CGTCTCTAC[T/C]CTATCTCTC with the thymine swapped for the cytosine giving the primers: Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5' Forward primer: 5' AAATATCTGGCTGAGTGTTT 3' These primers are 150 bp apart so as to allow the PCR reaction to occur faster, shortening the 30 seconds required per temperature cycled to 10 seconds per cycle.
| |
