BME103:W930 Group1 l2: Difference between revisions
| Line 118: | Line 118: | ||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->Heterotaxty (Hetero-different) (taxy-arrangement) syndrome is an uncommon birth defect that primary occurs in the heart. This disease can also occur in other organs but it is less likely. In this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->Heterotaxty (Hetero-different) (taxy-arrangement) syndrome is an uncommon birth defect that primary occurs in the heart. This disease can also occur in other organs but it is less likely. In this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. | ||
Revision as of 22:17, 25 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers Heterotaxty (Hetero-different) (taxy-arrangement) syndrome is an uncommon birth defect that primary occurs in the heart. This disease can also occur in other organs but it is less likely. In this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity.
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal. Forward primer sequence (position 136,651,203 – 136,651,223, read left-right): TCCCTGCGCAAACACATGAA Reverse primer sequence (200 base pairs to the right, read right-left): TCCCAACTTTGCTCACTCCC A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration
| ||||||||||||||||||||||||||||||||||||||||||||||

