BME103:W930 Group1 l2: Difference between revisions
Kevin M. Chu (talk | contribs) |
Kevin M. Chu (talk | contribs) |
||
| Line 83: | Line 83: | ||
Each DNA solution consists of<br> | Each DNA solution consists of<br> | ||
{| {{table}} | {| {{table}} | ||
| align="center" style="background:#f0f0f0;"| | | align="center" style="background:#f0f0f0;"|'''DNA Solution Component''' | ||
| align="center" style="background:#f0f0f0;”|'''Amount''' | | align="center" style="background:#f0f0f0;”|'''Amount''' | ||
|- | |- | ||
| Line 95: | Line 95: | ||
|- | |- | ||
| dH<sub>2</sub>O||47.8μL | | dH<sub>2</sub>O||47.8μL | ||
|- | |||
| Total||100.0μL | |||
|}<br> | |}<br> | ||
Revision as of 01:02, 26 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
Each DNA solution consists of
PCR Protocol
Research and DevelopmentBackground on Disease Markers Heterotaxty, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side. Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal. Forward primer sequence (position 136,651,203 – 136,651,223, read left-right): TCCCTGCGCAAACACATGAA Reverse primer sequence (200 base pairs to the right, read right-left): TCCCAACTTTGCTCACTCCC A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration http://www.google.com/imgres?q=specific+amplification+of+heterotaxy&um=1&hl=en&client=safari&sa=N&tbo=d&rls=en&biw=1206&bih=684&tbm=isch&tbnid=3QBwBiTFWqfSZM:&imgrefurl=http://www.ipej.org/0802S/sreeram.htm&docid=7LM9Ij0u5jwLgM&imgurl=http://www.ipej.org/0802S/sreeram3.jpg&w=500&h=590&ei=tp2yUIuGDoPniwKmr4HYCw&zoom=1&iact=rc&dur=445&sig=104840076601863359039&page=1&tbnh=128&tbnw=121&start=0&ndsp=26&ved=1t:429,r:4,s:0,i:99&tx=59&ty=47
| ||||||||||||||||||||||||||||||||||||||||||||||||||||

