BME103:T930 Group 17 l2: Difference between revisions
| Line 156: | Line 156: | ||
[[Image:PCR cancer reaction.png]] | [[Image:PCR cancer reaction.png]] | ||
[[Image:Cystic Fibrosis.png]] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Revision as of 00:37, 26 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
1. Gather all components for PCR reaction (template DNA, primers, Taq polymerase, magnesium chloride, and dNTP’s).
DNA Measurement Protocol Research and DevelopmentBackground on Disease Markers Alzheimer’s disease is the slow deterioration of the brain. There is no known cure for this disease and it eventually results in death. This disease usually begins with the inability to remember things that have recently happened and in the late stages patients will have much difficulty in remembering basic cognitive functions. The specific missense mutation that I am examining changes a Thymine to a Guanine on the ninth chromosome. This mutation has a 3.8 times increased risk for an early onset of Alzheimer’s. The data reference number is Rs908832. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=908832 Cystic Fibrosis is caused by a mutation of the protein cystic fibrosis transmembrane conductance regulator. This protein regulates the movement of chloride and sodium ions. Symptoms include slow growth, accumulation of mucus, chest infections, coughing, and shortness of breath. The average patient will be able to live 37 years. The specific mutation I am looking at is a deletion of three nucleotides on the seventh chromosome and causes the deletion of phenylalanine from the polypeptide. In 1979 about 70% of all cystic fibrosis patients carried this mutation. The data reference number is rs113993960. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=113993960
When testing the Alzheimer’s mutation the forward primer will be TGGCTCCACCACCTCGTGCCC and the reverse primer will be TTTGTGGGGCACGAGGTGGTG. When testing for the cystic fibrosis mutation the forward primer will be TCTTTTATAGTAACCACAAA and the reverse primer will be AACACCAAAGATATTTTCTT.
Illustration | ||||||||||||||||||||||||||||||||||


