BME103:T930 Group 17 l2: Difference between revisions
| Line 159: | Line 159: | ||
[[Image:PCR cancer reaction.png]] | [[Image:PCR cancer reaction.png]] | ||
The following illustration shows how a primer would not be able to bind to the mutation resulting in Cystic Fibrosis as it still contains the three nucleotides that would be deleted if their was a mutation present. Since the primer is designed for the mutated DNA the primer is not able to bond to the normal DNA, which results in zero amplification and a negative PCR result. The red parts show the SNP | The following illustration shows how a primer would not be able to bind to the mutation resulting in Cystic Fibrosis as it still contains the three nucleotides that would be deleted if their was a mutation present. Since the primer is designed for the mutated DNA the primer is not able to bond to the normal DNA, which results in zero amplification and a negative PCR result. The red parts show which three DNA nucleotides should be deleted due to the SNP. | ||
[[Image:Cystic Fibrosis.png]] | [[Image:Cystic Fibrosis.png]] | ||
Revision as of 00:44, 26 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
1. Gather all components for PCR reaction (template DNA, primers, Taq polymerase, magnesium chloride, and dNTP’s).
DNA Measurement Protocol Research and DevelopmentBackground on Disease Markers Alzheimer’s disease is the slow deterioration of the brain. There is no known cure for this disease and it eventually results in death. This disease usually begins with the inability to remember things that have recently happened and in the late stages patients will have much difficulty in remembering basic cognitive functions. The specific missense mutation that I am examining changes a Thymine to a Guanine on the ninth chromosome. This mutation has a 3.8 times increased risk for an early onset of Alzheimer’s. The data reference number is Rs908832. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=908832 Cystic Fibrosis is caused by a mutation of the protein cystic fibrosis transmembrane conductance regulator. This protein regulates the movement of chloride and sodium ions. Symptoms include slow growth, accumulation of mucus, chest infections, coughing, and shortness of breath. The average patient will be able to live 37 years. The specific mutation I am looking at is a deletion of three nucleotides on the seventh chromosome and causes the deletion of phenylalanine from the polypeptide. In 1979 about 70% of all cystic fibrosis patients carried this mutation. The data reference number is rs113993960. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=113993960
When testing the Alzheimer’s mutation the forward primer will be TGGCTCCACCACCTCGTGCCC and the reverse primer will be TTTGTGGGGCACGAGGTGGTG. When testing for the cystic fibrosis mutation the forward primer will be TCTTTTATAGTAACCACAAA and the reverse primer will be AACACCAAAGATATTTTCTT.
Illustration The following illustration is an example of how the primers for Alzheimer's disease would be able to bind to the template strand. Then the TAQ Polymerase would be able to amplify the DNA and result in a positive PCR reaction. The red shows the location of the SNP. The following illustration shows how a primer would not be able to bind to the mutation resulting in Cystic Fibrosis as it still contains the three nucleotides that would be deleted if their was a mutation present. Since the primer is designed for the mutated DNA the primer is not able to bond to the normal DNA, which results in zero amplification and a negative PCR result. The red parts show which three DNA nucleotides should be deleted due to the SNP. | ||||||||||||||||||||||||||||||||||


