BME103:W930 Group7 l2: Difference between revisions
Seong Song (talk | contribs) |
Seong Song (talk | contribs) |
||
| Line 144: | Line 144: | ||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. | The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. The allele sequence is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=63751320] | ||
| Line 151: | Line 151: | ||
Alzheimer- | Alzheimer- | ||
Alleles: [A/C] | Alleles: [A/C] | ||
Forward Primer:5' | Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' | ||
Reverse Primer:3'CCCGACACTAACCTCGTCTAACAC5' | Reverse Primer:3'CCCGACACTAACCTCGTCTAACAC5' | ||
The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. | The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. | ||
Revision as of 05:24, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design
Key Features
Instructions
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. The allele sequence is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]
Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAC5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
| |||||||||||||||||||||||||||||||||||





