BME103:W930 Group1 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 36: Line 36:


'''Key Features'''<br>
'''Key Features'''<br>
Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is heavy and hard to carry around. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only reduce the weight but also see the inner design of the machine easily. Last but not least, we can make the lid removable. This change is made to make sure we still have the access to the inner parts if repairs are needed.
Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is extremely fragile and the wooden outside does not provide much durability. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only increase durability but also see the inner design of the machine easily. Last but not least, we can make the lid removable. This change is made to make sure we still have the access to the inner parts if repairs are needed.





Revision as of 06:51, 28 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Kevin Chu
Experimemtal Protocol Planner
Name: Zhiyue
Open PCR Machine Engineer
Name: Vanessa Barker
Open PCR Machine Engineer
Name: Student
Role(s)
Name: Student
Role(s)
Name: Student
Role(s)
Name: Student
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

The picture shown above is the top of an Open PCR machine. This part consists of a LCD screen and a heating lid. The top of the machine has several issues. For example, the lid is hard to open. To solve these issues, we came up with some possible changes.


Key Features
Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is extremely fragile and the wooden outside does not provide much durability. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only increase durability but also see the inner design of the machine easily. Last but not least, we can make the lid removable. This change is made to make sure we still have the access to the inner parts if repairs are needed.


Instructions





Protocols

Materials

Supplied in the Kit Amount
PCR Machine 1
PCR Power Adapter 1
USB 2.0 Cable 1
Fluorimeter 1
Glass Slides 10
Black Box 1
DNA Solution 6 samples (600.0μL)
Positive Control Solution 1 sample (100.0μL)
Negative Control Solution 1 sample (100.0μL)
DNA Calf Thymus 1 sample (100.0μL)
Transfer Pipettes 10
Test Tubes (100μL) 8
Eppendorf Tubes 10
Tris Buffer (0.025% SYBR Green) 4L

Supplied by the User Amount
Smartphone 1
Plastic Phone Holder 1
Computer 1
Open PCR Software 1
ImageJ Software 1
Sharpie (fine point) 1
Distilled water 100.0μL
500mL graduated cylinder 1

Each DNA solution consists of

DNA Solution Component Amount
Patient’s Template DNA 0.2μL
10μM forward primer 1.0μL
10μM reverse primer 1.0μL
GoTaq master mix 50.0μL
dH2O 47.8μL
Total 100.0μL

PCR Protocol

  1. On your computer, download the Open PCR software.
  2. Place the PCR machine on a sturdy desk where it is unlikely to be disturbed, and turn on the machine.
  3. After turning on the Open PCR machine, plug it into an electrical outlet by using the power adapter provided in the kit.
  4. Connect the Open PCR machine to your computer by using the USB 2.0 cable.
  5. Create a new program on OpenPCR by clicking on “Add a new experiment.”
    • Click on the “more options” button.
    • Click on the plus symbol next to initial step, and type 95°C for temperature and 180 seconds for time.
    • In the third section, type in 30 for the number of cycles.
    • Set the denaturing temperature to 95°C and time to 30 seconds.
    • Set the annealing temperature to 57°C and time to 30 seconds.
    • Set the extending temperature to 72°C and time to 30 seconds.
    • Add a final step. Set the temperature to 72°C and the time to 180 seconds.
    • Set the final hold to 4°C.
  6. Use one pipette to transfer one of the extracted DNA samples into one of the PCR test tubes.
  7. Next, add the forward and reverse primers to the test tube, using different pipettes for each.
  8. Then, use another pipette to transfer GoTaq master mix into the DNA/primer mixture.
  9. Dilute the contents of the test tube by filling its remainder with deionized water.
  10. Repeat steps 6-9 for each of the seven remaining DNA samples including the positive and negative controls using different pipettes to transfer
    each substance.
  11. Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid and tighten the screw so that it
    barely touches the tops of the tubes.
  12. Using a fine point Sharpie, label each of the test tubes. Number the experimental DNA samples from 1 to 6, and label the positive and negative
    controls accordingly.
  13. Click on “Plug in Open PCR to start” to begin amplifying DNA samples.
  14. Carefully observe the display screen on the lid of the Open PCR with the quantities that appear on the computer.
    • If these quantities are close, then continue running the program.
    • If these quantities are not close, then discontinue the program and try again.
  15. Run the program for two hours to allow the PCR machine to amplify DNA 30 times. Ensure that all of the components are functioning properly.



DNA Measurement Protocol

  1. Open the lid of the PCR machine, and remove the 8 samples from the PCR tray.
  2. With the fine point Sharpie, label the transfer pipettes and Eppendorf tubes accordingly to prevent contamination.
  3. Measure 400mL of Tris buffer into a 500mL graduated cylinder and pour into each of the Eppendorf tubes.
  4. Extract each sample with one pipette into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the sample into the tube.
    Label the Eppendorf tube with the sample number.
  5. Set up the sample DNA calf thymus by pipetting 100μL into an Eppendorf tube containing 400mL of Tris buffer.
  6. Pipette 100μL of distilled water into the corresponding Eppendorf tube containing 400mL of Tris buffer.
  7. Place a glass slide onto the fluorimeter.
  8. Next, unbutton one side of the black box, and lift the flap so that it rests on top of the box. Place the box upside down and position it so that the
    fluorimeter lies in the center of the box.
  9. Turn on the fluorimeter so that a blue light shines.
  10. From one of the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on
    a glass slide. The two drops should combine to form a single larger drop.
  11. Dull the lights in the room, letting in as little light as possible into the box containing the fluorimeter.
  12. On the Smartphone, adjust the following settings
    • Turn off the flash.
    • Increase the ISO to 800 or higher.
    • Set the white balance to auto.
    • Maximize the exposure setting.
    • Maximize the saturation setting.
    • Minimize the contrast setting.
  13. Take an image of the fluorimeter and the drop, and record the image number and DNA sample. If desired, take another photograph of the drop.
  14. Repeat steps 7,10, and 13 for the 9 remaining DNA solutions using a different glass slide for each sample.
  15. Once you have taken all of the pictures, download them onto the computer.
  16. Right click on the file name of the picture and open with Image J.
  17. In Image J, select Analyze > Set Measurements and choose area, integrated density, and mean grey value.
  18. Select Image > Color > Split Channels. Three images will appear; choose the one named green.
  19. Draw an oval around the drop. Then, go to analyze and measure, and record the measurements.
  20. Obtain the background reading by moving the oval over the dark area around the drop, and record the INTDEN and RAWINTDEN.
  21. Repeat steps 16-20 for all of the pictures. Make sure each sample lines up with the correct INTDEN measurements.
  22. Subtract the INTDEN background measurement from the INTDEN drop measurement.
  23. Set the DNA concentration in water to 0μg/mL and the DNA concentration in the calf thymus sample to 2μg/mL.
  24. Use a graphing program to generate a plot of INTDEN (with background subtracted) versus concentration. Select the option to display the linear equation.
  25. Use the linear equation and the INTDEN values of the samples to determine their concentrations.
  26. Once the DNA concentrations of the positive and negative are known, you can determine whether samples give a positive or negative result for heterotaxty.

Research and Development

Background on Disease Markers

Heterotaxty, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side.

Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962



Primer Design

The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal.

Forward primer sequence (position 136,651,203 – 136,651,223, read left-right): TCCCTGCGCAAACACATGAA

Reverse primer sequence (200 base pairs to the right, read right-left): TCCCAACTTTGCTCACTCCC

A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.


Illustration

http://www.google.com/imgres?q=specific+amplification+of+heterotaxy&um=1&hl=en&client=safari&sa=N&tbo=d&rls=en&biw=1206&bih=684&tbm=isch&tbnid=3QBwBiTFWqfSZM:&imgrefurl=http://www.ipej.org/0802S/sreeram.htm&docid=7LM9Ij0u5jwLgM&imgurl=http://www.ipej.org/0802S/sreeram3.jpg&w=500&h=590&ei=tp2yUIuGDoPniwKmr4HYCw&zoom=1&iact=rc&dur=445&sig=104840076601863359039&page=1&tbnh=128&tbnw=121&start=0&ndsp=26&ved=1t:429,r:4,s:0,i:99&tx=59&ty=47

This represents the primers binding to the diseased A gene in a gene sequence that expresses the heterotaxy disease.