Name: Tyler Ray Research and development scientist
Name: Seth Howell R&D
Name: Ryan Open PCR machine engineer
Name: Hamas Protocol
Name: Deanna Open PCR machine engineer
Name: Daniela R&D
Everyone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
The image above portrays the main heating block located inside the OpenPCR.
Consequently, the entire dimensions of the OpenPCR will increase accordingly, to fit the new 5x5 heating block.
An example is shown in the image above, indicating that the lid of the device
will increase to accommodate the new heating block.
Key Features
The key features of the new design include
Instructions
Protocols
Materials
PCR Protocol
DNA Measurement Protocol
Research and Development
Background on Disease Markers
The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([1]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [2]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [3].
Primer Design
Forward primer
5'AAAAAAACAATCTTTTAAACAC3'
Reverse Primer
3'TGTTTACTTACCGTAGCTTC5'
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.