BME103:T930 Group 12 l2: Difference between revisions
| Line 88: | Line 88: | ||
• Gene being affected: SERPINA3 <br> | • Gene being affected: SERPINA3 <br> | ||
• SNP (Single Nucleotide Polymorphism): Rs4934<br> | • SNP (Single Nucleotide Polymorphism): Rs4934<br> | ||
• Located in position # 95,080,803 <br> <br> 5'GAATGGAGAGAATGTTACCTCTCCTG[A/G]CTCTGGGGCTCTTGGCGGCTGGGTT3’ <br> 3’CTTACCTCTCTTACAATGGAGAGGAC[T/C]GAGACCCCGAGAACCGCCGACCCAA5’<br><br> | • Located in position # 95,080,803 <br> <br> | ||
• 5'GAATGGAGAGAATGTTACCTCTCCTG'''[A/G]'''CTCTGGGGCTCTTGGCGGCTGGGTT3’ <br> | |||
• 3’CTTACCTCTCTTACAATGGAGAGGAC'''[T/C]'''GAGACCCCGAGAACCGCCGACCCAA5’<br><br> | |||
• Forward Primer:<br><br> | • Forward Primer:<br><br> | ||
o 3’TGGAGAGGAC'''C'''GAGACCCCG5’<br><br> | o 3’TGGAGAGGAC'''C'''GAGACCCCG5’<br><br> | ||
Revision as of 02:02, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||
OUR TEAM
LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.< Our design manipulates the 4x4 PCR Tube Block to a 3x7 block capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 test tube spaces will be inserted with a platinum temperature sensor. The platinum temperature sensor reads the temperature more accurately, and since it reads the temperature more accurately it saves more time.
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Primer Design
Surrounding sequence of Rs4934:
Illustration
| ||||||

