BME103:T930 Group 14 l2: Difference between revisions
| Line 127: | Line 127: | ||
'''DNA Measurement Protocol''' | '''DNA Measurement Protocol''' | ||
'''DNA Sample Preparation''' | |||
# Obtain all the DNA samples run through the Open PCR machine along with calf thymus DNA and a water sample. | |||
# Take the provided Eppendorf tubes with 400 mL of buffer solution and label them in conjuction with labeling pipettes. Maintain constant labels to avoid contamination. | |||
# Transfer each DNA sample, positive control, negative control, and calf thymus DNA into a separate eppendorf tube with its labeled pipette. This does not need to be done with water. | |||
'''Fluorimeter Setup'''<br> | |||
*Procedure: | |||
# Obtain a box of materials including: Fluorimeter, phone stand, hydrophobic slides, pipettes, Sybr Green, and the 9 eppendorf tubes prepared earlier. | |||
# The hydrophobic slide (polymer side up) should be placed onto the LED box with the first two rows of nodes centered with the LED light. | |||
# For each sample two drops of the Sybr Green Dye are added to the center nodes of the slide. That is, in the first two horizontal rows with the two central dots of each connecting. One drop for each node, or until the two drops coalesce. | |||
# Two drops of the subjects DNA mixture (or positive/negative control or Calf Thymus DNA or water sample as appropriate) solution were added to the dye. | |||
# The LED was turned on and the phone camera was centered onto the drop, held up by the stand. | |||
# The dark box was placed over the whole setup and closed as completely as possible. | |||
# A picture was taken and sent to the ImageJ program to be analyzed. | |||
# The drop was removed and disposed of and the slide was re centered on the next two nodes. | |||
# The whole procedure was repeated for each sample with the phone in the same place in relation to the drop throughout the entire procedure. | |||
==Research and Development== | ==Research and Development== | ||
Revision as of 04:36, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
What changes are we making to our system? Will have to take another picture with changes before class!
ProtocolsMaterials
DNA Measurement Protocol DNA Sample Preparation
Fluorimeter Setup
Research and DevelopmentBackground on Disease Markers ALZHEIMER'S DISEASE (AD) As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors. Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)
Primer Design ALZHEIMER'S DISEASE (AD) Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.
| |||||||||||||||||||||||||






