BME103:T930 Group 14 l2: Difference between revisions
| Line 39: | Line 39: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
Our redesigned system will have the adjusting heated lid handle (the turning knob and screw) removed. As the original design is, the heated lid handle twists in order to move the mounting plate and heating plate, which are attached to each other by four screws. Instead, heating plate will be fixed at a set level that, when the heating lid is closed, the heating plate will rest on top of the solution filled PCR tubes being held in the heating block. This adjustment is being made so that the operator will not have to fiddle with adjusting the lid to fit on top of the tubes in the Open PCR machine. The lid can be simply opened and closed with ease without worrying about the height of the heating plate. <br> | Our redesigned system will have the adjusting heated lid handle (the turning knob and screw) removed. As the original design is, the heated lid handle twists in order to move the mounting plate and heating plate, which are attached to each other by four screws. Instead, heating plate will be fixed at a set level that, when the heating lid is closed, the heating plate will rest on top of the solution filled PCR tubes being held in the heating block. This adjustment is being made so that the operator will not have to fiddle with adjusting the lid to fit on top of the tubes in the Open PCR machine. The lid can be simply opened and closed with ease without worrying about the height of the heating plate. The entire lid can still be lifted by the lip of the top wooden piece. <br> | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
The instructions for this system are the same as the | The instructions for this system are the same as the original Open PCR Machine, minus the step where the heated lid handle is added. | ||
The following link provides the original manual: [[Media:PCR guide.pdf]]<br> | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Revision as of 05:28, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
The following link provides the original manual: Media:PCR guide.pdf
ProtocolsMaterials
DNA Measurement Protocol DNA Sample Preparation
Fluorimeter Setup
ImageJ Analysis
Research and DevelopmentBackground on Disease Markers ALZHEIMER'S DISEASE (AD) As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors. Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)
Primer Design ALZHEIMER'S DISEASE (AD) Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.
| |||||||||||||||||||||||||||||||





