BME103:T130 Group 17 l2: Difference between revisions
| Line 72: | Line 72: | ||
|Pre-labeled bulb pipets || 34 pipets | |Pre-labeled bulb pipets || 34 pipets | ||
|- | |- | ||
|20 µM forward primer ( | |20 µM forward primer (Autism) || 2.0 μL | ||
|- | |- | ||
|20 µM reverse primer ( | |20 µM reverse primer (Autism) || 2.0 μL | ||
|- | |- | ||
|GoTaq Master Mix || 100.0 μL | |GoTaq Master Mix || 100.0 μL | ||
| Line 102: | Line 102: | ||
2. Put the DNA into the special PCR tube. | 2. Put the DNA into the special PCR tube. | ||
3. Add forward primer ( | 3. Add forward primer (Autism) to the PCR tube with the DNA. | ||
4. Add reverse primer ( | 4. Add reverse primer (Autism) to the PCR tube with DNA. | ||
5. Add Nucleotides (the A,C,T,and G). | 5. Add Nucleotides (the A,C,T,and G). | ||
Revision as of 20:28, 29 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||
GROUP 17LAB 2 WRITE-UP: Redesigning Open PCR for Autism DetectionThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Instructions
ProtocolsMaterial Tables
PCR Protocol Step by Step instruction to amplify the Patient's DNA Sample: 1. Need to extract the DNA from the patient. 2. Put the DNA into the special PCR tube. 3. Add forward primer (Autism) to the PCR tube with the DNA. 4. Add reverse primer (Autism) to the PCR tube with DNA. 5. Add Nucleotides (the A,C,T,and G). 6. Add the DNA polymerase to the PCR tube. 7. Place the PCR tube into the thermal cycler. 8. Set the temperature of the thermal cycler to 95°C and set the machine to run 30 cycles. 9. Now the thermal cycler cools down to 50°C and forward and reverse primer attach to the single strands of DNA. 10. Now the thermal cycler temperature changes to 72°C. This begins the DNA polymerase. This pairs the DNA with its complimentary nucleotide through to the end of the DNA strand. 11. Repeat step 8-10 29 more times. 12. During cycle #3 the wanted DNA begins to appear. 13. The wanted piece of the DNA begins to double. 14. After 30 cycles are complete over a billion wanted DNA fragments will show in the DNA solution and there will be 60 copies of unwanted DNA molecules in the solution.
1. Turn on the blue light in the Flourimeter using the switch for the Blue LED. 2. Place the smart phone in the cradle provided at the right angle and distance from the slide. 3. Turn on the camera on the phone. TURN OFF THE FLASH. Set the ISO to 800 or higher. Increase the exposure to maximum. 4. Adjust the distance between phone and the first two rows of dots of the slide so that the picture will be clear and the camera does not give a blurred image. 5.First label the blank pipettes according to the patients (A,B,C,D... all eight of them). The pipettes given by the instructor are color coded. The white coded pipette is used for water. the red coded pipette is used for the calibrator (the tube with the red dot). The blue coded pipette is used for the sybrgreen (the tube with the blue dot). The black coded pipette is used to pick up the waste and put it in the cup that collects the waste droplets. 6. Align the slide so that the blue dot passed between the first two dots on the slide in the middle column. First calibrate the machine (to make sure the machine works). To calibrate the machine first put two drops of water on each dot and if the droplets are not connected then add a third droplet to combine the two separate droplets to one droplet. Put two droplets of the cyber green on the first two dots in the middle. 7. Then set the smart phone accordingly to take a clear picture of the droplet. Then put the black box on top of the phone and the machine so that when the the light is completely blocked and the shade of blue of green is shown when the picture is taken. 8. Record observations. 9. Remove the solution from the glass dish using the black pipette and discard it in the plastic cup given for the waste droplets. 10.Repeat step 6-9, but instead of adding calibrator solution, add 2 droplets of water. 11.Repeat steps 6-9 for patient 1 solutions (A,B,C,D) and patient 2 solutions (A2.B2,C2,D2). Research and DevelopmentBackground on Disease Markers
rs122468182 [Homo sapiens] CCTCAAATGATTATTTAGATCCAGAA[G/T]ATAGAAAGTTTTTGGAAAGTTATGC http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=122468182
DNA Sequence: CCTCAAATGATTATTTAGATCCAGAA[G/T]ATAGAAAGTTTTTGGAAAGTTATGC Alleles: [G/T] Allele Change: TAT --> GAT Forward Primer: 3' AGAAACTAGTAGTAACTTCC 5' Reverse Primer: 3' AGATCCAGAAGATAGAAAGTT 5' The allele change from T to G will be replicated in the PCR because our design detects this specific mutation, which will produce a positive reading. If the allele change had not occurred, the PCR will not replicate this gene which will produce a negative reading.
Bayes Rule P(A|B) is the probability that Autism will occur in a positive sample (PCR Test Result). P(B|A)is the probability that child will test positive for Autism. P(A) is the probability of having Autism in the mutation and P(B) is the probability of humans without the Autism mutation that could yield positive results. | |||||||||||||||||||||||||||




