BME103 s2013:T900 Group4 L3: Difference between revisions
Anna Essex (talk | contribs) |
Anna Essex (talk | contribs) |
||
| Line 220: | Line 220: | ||
* '''PCR Protocol''' | * '''PCR Protocol''' | ||
<!-- Create a step-by-step procedure for setting up and running PCR reactions. Your instructions should include everything from adding reagents to the tubes, to programming the PCR machine and running the reaction.--> | <!-- Create a step-by-step procedure for setting up and running PCR reactions. Your instructions should include everything from adding reagents to the tubes, to programming the PCR machine and running the reaction.--> | ||
# | # Obtain and label 8 50μL DNA samples (4 each from 2 patients, positive control, negative control) and 8 50μL tubes of PCR reaction mix | ||
# | # Set micropipette to 75μL and attach disposable tip | ||
# | # Transfer all of the liquid from positive control DNA sample to a reaction mix tube, discard tip, label tube | ||
# | # Repeat for the remaining 7 DNA samples | ||
# | # Set the PCR program to run three stages | ||
-1 | {| {{table}} width=700 | ||
-2 | |- | ||
-3 | | '''Stage''' || '''Number of Cycles''' || '''Temperature (°C)''' || Duration | ||
-Final hold | |- | ||
| 1 || 1 || 95 || 3 minutes | |||
|- | |||
| 2 || 35 || 95 || 30 seconds | |||
|- | |||
| || || 57 || 30 seconds | |||
|- | |||
| || || 72 || 30 seconds | |||
|- | |||
| 3 || || 72 || 3 minutes | |||
|- | |||
| Final hold || || 4 | |||
|} | |||
| Line 234: | Line 247: | ||
* '''DNA Measurement and Analysis Protocol''' | * '''DNA Measurement and Analysis Protocol''' | ||
<!-- Create a step-by-step procedure for measuring DNA amplification in the PCR reactions. Your instructions should include everything from diluting the samples in SYBR Green, to placing the drops onto the fluorimeter (if your group is using the fluorimeter), to collecting and processing images in Image J. Don't forget to provide instructions on how to set up the calf thymus DNA samples for calibration, and how to convert INTDEN values into concentrations.---> | <!-- Create a step-by-step procedure for measuring DNA amplification in the PCR reactions. Your instructions should include everything from diluting the samples in SYBR Green, to placing the drops onto the fluorimeter (if your group is using the fluorimeter), to collecting and processing images in Image J. Don't forget to provide instructions on how to set up the calf thymus DNA samples for calibration, and how to convert INTDEN values into concentrations.---> | ||
# | # Obtain a tray of sample tubes (8 buffer, 2 SYBR GREEN, 1 H<sub>2</sub>O, 5 calf Thymus DNA, 8 PCR reaction samples) | ||
# | # Set micropipette to 120μL and attach disposable tip | ||
# | # Transfer all of the liquid from positive control PCR sample to a buffer tube, discard tip, label tube | ||
# Step 4: Repeat for the remaining 7 PCR samples | # Step 4: Repeat for the remaining 7 PCR samples | ||
# Step 5: Take a picture of the experiment | # Step 5: Take a picture of the experiment | ||
Revision as of 10:26, 16 April 2013
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have: - easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool. - Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine. We concluded that we would Want a good system to have: - Low cost: Currently an OpenPCR machine costs $599 and a Fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. - integrated camera: phone cameras are easily moveable and vary in size and quality, leading to differing results. Smartphone camera settings can be time consuming or nonexistent. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. Furthermore, the program is simpler because it does not have to adjust to different cameras and phone sizes and shapes vary enough to make building a cradle to fit them difficult.
- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work. - Casing = fire hazard. High temperature with PCR can be dangerous.
We concluded that a good system Should Avoid: - Avoid slow amplification. - Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.
New System: Machine/ Device EngineeringSYSTEM DESIGN
Fluorimeter - We chose to include these new features:
PCR Machine - We chose keep these features the same as the original system:
New System: ProtocolsDESIGN
New System: Research and DevelopmentBACKGROUND
DESIGN
GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


