BME103 s2013:T900 Group4 L3: Difference between revisions
| Line 269: | Line 269: | ||
CHEK2 is a gene located at chromosome 22. It provides instructions for making protein called checkpoint kinase 2, a tumor suppressor. This particular protein responds to damage in DNA, preventing the cell from entering mitosis when the cell's DNA deviates from normal. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases. | CHEK2 is a gene located at chromosome 22. It provides instructions for making protein called checkpoint kinase 2, a tumor suppressor. This particular protein responds to damage in DNA, preventing the cell from entering mitosis when the cell's DNA deviates from normal. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases. | ||
<br> | |||
'''DESIGN''' | '''DESIGN'''<br> | ||
In our design, we chose to | In our design, we chose to use primers for both normal and cancer-associated DNA sequences. This addition of primers associated with the normal sequence allows users to test for the presence of normal DNA if they suspect that the cancer-associated DNA is not present. This helps fulfill our goal of making a more reliable test. It takes more time to run more samples, but it provides an extra layer of caution to help ensure correct diagnosis. | ||
<br> | |||
'''Primers for PCR'''<br> | '''Primers for PCR'''<br> | ||
<!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | <!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | ||
'Normal Allele'<br> | |||
Forward Primer: TATGTATGCAATGTAAGAGTT | |||
Reverse Primer: TGAACCACTGGTGAAAAGAAC | |||
<br> | |||
'Cancerous Allele'<br> | |||
Forward Primer: ATACATACGTGACATTCTCAA | |||
Reverse Primer: TGAACCACTGGTGAAAAGAAC | |||
<br> | |||
<!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | <!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | ||
Revision as of 13:40, 16 April 2013
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have: - easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool. - Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine. We concluded that we would Want a good system to have: - Low cost: Currently an OpenPCR machine costs $599 and a Fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. - integrated camera: phone cameras are easily moveable and vary in size and quality, leading to differing results. Smartphone camera settings can be time consuming or nonexistent. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. Furthermore, the program is simpler because it does not have to adjust to different cameras and phone sizes and shapes vary enough to make building a cradle to fit them difficult.
- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work. - Casing = fire hazard. High temperature with PCR can be dangerous.
We concluded that a good system Should Avoid: - Avoid slow amplification. - Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.
New System: Machine/ Device EngineeringSYSTEM DESIGN
Fluorimeter - We chose to include these new features:
PCR Machine - We chose keep these features the same as the original system:
New System: ProtocolsDESIGN
New System: Research and DevelopmentBACKGROUND CHEK2 is a gene located at chromosome 22. It provides instructions for making protein called checkpoint kinase 2, a tumor suppressor. This particular protein responds to damage in DNA, preventing the cell from entering mitosis when the cell's DNA deviates from normal. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases.
DESIGN Primers for PCR
New System: SoftwareAs has been seen by the several groups who already have software in development, the need for more efficient PCR and image analysis capabilities are growing. For our particular machine, an app allowing a smartphone to control the integrated fluorimeter camera would be most essential, and ideally this app could also perform image analysis, lessening the complication of transferring large quantities of images that all look very similar to the human eye.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



