Registry/Measurement kit/Notebook/2007-6-19: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 1: Line 1:
*Growth only on the Kan plate - doing a colony PCR to check.
==Colony PCR==
**note: 72° is the extension step.
*Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies.
**Spun down cultures with other devices, plating them for overnight.
*See [[Endy:Colony_PCR]]
**note: 72° is the extension step. taq is in shared polymerase box in first room
 
==Prepared chemically competent cells==
*see [[Preparing_chemically_competent_cells|protocol]]
 
==Analytic Gel of Colony PCR==
*All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow.
**note: ladder in Controls box in -20, loading buffer in -4.
*Made overnight culture of colony 8.


==Ordered primers for E0240==
==Ordered primers for E0240==
*E0240_F -- '''CTTAGTAG ''CAATTG''''' TCACACAGGAAAGTACTAGATGCG
*E0240_F -- '''CTTAGTAG ''CAATTG''''' TCACACAGGAAAGTACTAGATGCG
*E0240_R -- '''TCAGCCAT ''ATGCAT''''' TATAAACGCAGAAAGGCCCAC
*E0240_R -- '''TCAGCCAT ''ATGCAT''''' TATAAACGCAGAAAGGCCCAC
**in Vector NTI, go to analysis -> oligo analysis


Bold is tail, italics is restriction site.
Bold is tail, italics is restriction site.

Revision as of 06:16, 20 June 2007

Colony PCR

  • Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies.
    • Spun down cultures with other devices, plating them for overnight.
  • See Endy:Colony_PCR
    • note: 72° is the extension step. taq is in shared polymerase box in first room

Prepared chemically competent cells

Analytic Gel of Colony PCR

  • All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow.
    • note: ladder in Controls box in -20, loading buffer in -4.
  • Made overnight culture of colony 8.

Ordered primers for E0240

  • E0240_F -- CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGCG
  • E0240_R -- TCAGCCAT ATGCAT TATAAACGCAGAAAGGCCCAC
    • in Vector NTI, go to analysis -> oligo analysis

Bold is tail, italics is restriction site.