Registry/Measurement kit/Notebook/2007-6-19: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
*Growth only on the Kan plate | ==Colony PCR== | ||
**note: 72° is the extension step. | *Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies. | ||
**Spun down cultures with other devices, plating them for overnight. | |||
*See [[Endy:Colony_PCR]] | |||
**note: 72° is the extension step. taq is in shared polymerase box in first room | |||
==Prepared chemically competent cells== | |||
*see [[Preparing_chemically_competent_cells|protocol]] | |||
==Analytic Gel of Colony PCR== | |||
*All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow. | |||
**note: ladder in Controls box in -20, loading buffer in -4. | |||
*Made overnight culture of colony 8. | |||
==Ordered primers for E0240== | ==Ordered primers for E0240== | ||
*E0240_F -- '''CTTAGTAG ''CAATTG''''' TCACACAGGAAAGTACTAGATGCG | *E0240_F -- '''CTTAGTAG ''CAATTG''''' TCACACAGGAAAGTACTAGATGCG | ||
*E0240_R -- '''TCAGCCAT ''ATGCAT''''' TATAAACGCAGAAAGGCCCAC | *E0240_R -- '''TCAGCCAT ''ATGCAT''''' TATAAACGCAGAAAGGCCCAC | ||
**in Vector NTI, go to analysis -> oligo analysis | |||
Bold is tail, italics is restriction site. | Bold is tail, italics is restriction site. | ||
Revision as of 06:16, 20 June 2007
Colony PCR
- Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies.
- Spun down cultures with other devices, plating them for overnight.
- See Endy:Colony_PCR
- note: 72° is the extension step. taq is in shared polymerase box in first room
Prepared chemically competent cells
- see protocol
Analytic Gel of Colony PCR
- All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow.
- note: ladder in Controls box in -20, loading buffer in -4.
- Made overnight culture of colony 8.
Ordered primers for E0240
- E0240_F -- CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGCG
- E0240_R -- TCAGCCAT ATGCAT TATAAACGCAGAAAGGCCCAC
- in Vector NTI, go to analysis -> oligo analysis
Bold is tail, italics is restriction site.