Registry/Measurement kit/Notebook/2007-6-20: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 10: | Line 10: | ||
*Eluted with 30µL of EB. | *Eluted with 30µL of EB. | ||
*For future reference: when sequencing, should elute with aqueous NaOH solution of pH 8.5 | *For future reference: when sequencing, should elute with aqueous NaOH solution of pH 8.5 | ||
**Will probably need to re-do this... | |||
=="Device B" Primers== | =="Device B" Primers== | ||
Revision as of 18:50, 20 June 2007
To Do
- Add new devices into the Registry
- Check re-plating of devices A and C (done. no growth.)
- Create/order primers for device B
- Mini-prep and sequence device B culture (colony 8) and Jason's three cultures
Mini-Prep
- Spun at 5k for 4.5 min before prepping
- note: accidentally added 250 of P1 to each tube instead of each culture, but reconsolidated into four miniprep columns. We'll see if this affects the results drastically.
- Eluted with 30µL of EB.
- For future reference: when sequencing, should elute with aqueous NaOH solution of pH 8.5
- Will probably need to re-do this...
"Device B" Primers
- Fwd
- MfeI tail + tccctatcagtgatagagattgacatc
- Rev
- NsiI tail + TATAAACGCAGAAAGGCCCAC