IGEM:Harvard/2007/Two Component Systems: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
EllenorB (talk | contribs)
EllenorB (talk | contribs)
Line 45: Line 45:
== Brainstorming ==
== Brainstorming ==


'''6/28/07'''
Given the complexity of reengineering a receptor binding site such that it binds with a target other than its wild type ligand, we could create a "negative gate."  The target will block ferric citrate from binding, thus turning off the FecA signal.  Loops 9 and 10 look promising because they are accessible and do not participate in the binding of ferric citrate (they do not contain binding residues).  Loop 11 would be another choice except that it has binding residues.


==Readings==
==Readings==

Revision as of 20:09, 28 June 2007

FecA Two Component System

In the beginning, our team decided to use cells as biosensors, used to bind to targets, like breast cancer cells. We were later compelled to up the ante. So, we directed our thinking toward a 2 component system where E Coli would bind to a target and then produce a reporting signal. From this came the search for E Coli outer membrane receptors that are already part of a signally pathway, trying to do as little signal pathway re-engineering as possible. There are very few outer membrane receptors that suit our purpose. In fact, there is only one that we could find: FecA.

Using the FecA receptor from the outer membrane of Escherichia Coli, we hope to bind to given targets and produce a reporting signal. We originally planned to insert a random peptide library into the FecA protein and see which n-mer binds to our target. And this receptor-ligand binding should set off the FecA signalling pathway. The concerns presented are:

1) Where should the random library be inserted? FecA has several loops which serve as potential sites for insertion. Literature suggests that the conformational changes of loops 7 and 8 are most critical to binding and signal production. So then, would it be best to insert a library into these loops? Would it be best to use several locations and several libraries at once to get the correct response?

2) Random library insertion is a game of chance, given the number of possibilities that can be produced and biases in different methods of producing random libraries. And how does the insertion of new peptides effect specificity? THUS....

3) Computational methods of predicting which sequences produce the desired binding and signal are attractive, but are at this point unknown to us. These methods (IPRO, CHARMM, dead end elimination) have not been attempted with FecA, as far as we can tell. They are also fairly new methods. Our advantage is that FecA is well characterized liganded and unliganded, which is much easier than creating a protein from scratch that will bind to a particular target. In this vein, we have contacted several researchers who have produced papers on computational design of proteins, receptors in particular.

Planned Work

Completed Work

6/27/07

Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’


Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for Miniprep and sequencing tomorrow. Inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.


6/28/07 Miniprep done. Sent for sequencing.

Emails sent to:

Duke: Dr. Homme W. Hellinga Dr. Loren L. Looger

Penn State: Dr. Hossein Fazelinia Dr. Costas D. Maranas Dr. Gregory L. Moore

Brainstorming

6/28/07

Given the complexity of reengineering a receptor binding site such that it binds with a target other than its wild type ligand, we could create a "negative gate." The target will block ferric citrate from binding, thus turning off the FecA signal. Loops 9 and 10 look promising because they are accessible and do not participate in the binding of ferric citrate (they do not contain binding residues). Loop 11 would be another choice except that it has binding residues.

Readings

  1. Koebnik R, Locher KP, and Van Gelder P. Structure and function of bacterial outer membrane proteins: barrels in a nutshell. Mol Microbiol. 2000 Jul;37(2):239-53. DOI:10.1046/j.1365-2958.2000.01983.x | PubMed ID:10931321 | HubMed [FecAPorins1]
  2. Vica Pacheco S, García González O, and Paniagua Contreras GL. The lom gene of bacteriophage lambda is involved in Escherichia coli K12 adhesion to human buccal epithelial cells. FEMS Microbiol Lett. 1997 Nov 1;156(1):129-32. DOI:10.1111/j.1574-6968.1997.tb12717.x | PubMed ID:9368371 | HubMed [FecAPorins2]
  3. Wimley WC. The versatile beta-barrel membrane protein. Curr Opin Struct Biol. 2003 Aug;13(4):404-11. DOI:10.1016/s0959-440x(03)00099-x | PubMed ID:12948769 | HubMed [FecAPorins3]
  4. Braun V, Mahren S, and Sauter A. Gene regulation by transmembrane signaling. Biometals. 2006 Apr;19(2):103-13. DOI:10.1007/s10534-005-8253-y | PubMed ID:16718597 | HubMed [FecAPorins4]
  5. Ferguson AD, Amezcua CA, Halabi NM, Chelliah Y, Rosen MK, Ranganathan R, and Deisenhofer J. Signal transduction pathway of TonB-dependent transporters. Proc Natl Acad Sci U S A. 2007 Jan 9;104(2):513-8. DOI:10.1073/pnas.0609887104 | PubMed ID:17197416 | HubMed [FecAPorins5]
  6. Braun V, Mahren S, and Sauter A. Gene regulation by transmembrane signaling. Biometals. 2006 Apr;19(2):103-13. DOI:10.1007/s10534-005-8253-y | PubMed ID:16718597 | HubMed [FecAPorins6]
  7. Ferguson AD, Chakraborty R, Smith BS, Esser L, van der Helm D, and Deisenhofer J. Structural basis of gating by the outer membrane transporter FecA. Science. 2002 Mar 1;295(5560):1715-9. DOI:10.1126/science.1067313 | PubMed ID:11872840 | HubMed [FecAPorins7]
  8. Sauter A and Braun V. Defined inactive FecA derivatives mutated in functional domains of the outer membrane transport and signaling protein of Escherichia coli K-12. J Bacteriol. 2004 Aug;186(16):5303-10. DOI:10.1128/JB.186.16.5303-5310.2004 | PubMed ID:15292131 | HubMed [FecAPorins8]
  9. Yue WW, Grizot S, and Buchanan SK. Structural evidence for iron-free citrate and ferric citrate binding to the TonB-dependent outer membrane transporter FecA. J Mol Biol. 2003 Sep 12;332(2):353-68. DOI:10.1016/s0022-2836(03)00855-6 | PubMed ID:12948487 | HubMed [FecAPorins9]
  10. Garcia-Herrero A and Vogel HJ. Nuclear magnetic resonance solution structure of the periplasmic signalling domain of the TonB-dependent outer membrane transporter FecA from Escherichia coli. Mol Microbiol. 2005 Dec;58(5):1226-37. DOI:10.1111/j.1365-2958.2005.04889.x | PubMed ID:16313612 | HubMed [FecAPorins10]
  11. Breidenstein E, Mahren S, and Braun V. Residues involved in FecR binding are localized on one side of the FecA signaling domain in Escherichia coli. J Bacteriol. 2006 Sep;188(17):6440-2. DOI:10.1128/JB.00741-06 | PubMed ID:16923915 | HubMed [FecAPorins11]
  12. Russ WP, Lowery DM, Mishra P, Yaffe MB, and Ranganathan R. Natural-like function in artificial WW domains. Nature. 2005 Sep 22;437(7058):579-83. DOI:10.1038/nature03990 | PubMed ID:16177795 | HubMed [FecAPorins12]
  13. Looger LL, Dwyer MA, Smith JJ, and Hellinga HW. Computational design of receptor and sensor proteins with novel functions. Nature. 2003 May 8;423(6936):185-90. DOI:10.1038/nature01556 | PubMed ID:12736688 | HubMed [FecAPorins13]
  14. Dwyer MA, Looger LL, and Hellinga HW. Computational design of a Zn2+ receptor that controls bacterial gene expression. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11255-60. DOI:10.1073/pnas.2032284100 | PubMed ID:14500902 | HubMed [FecAPorins14]
  15. Looger LL and Hellinga HW. Generalized dead-end elimination algorithms make large-scale protein side-chain structure prediction tractable: implications for protein design and structural genomics. J Mol Biol. 2001 Mar 16;307(1):429-45. DOI:10.1006/jmbi.2000.4424 | PubMed ID:11243829 | HubMed [FecAPorins15]
  16. Fazelinia H, Cirino PC, and Maranas CD. Extending Iterative Protein Redesign and Optimization (IPRO) in protein library design for ligand specificity. Biophys J. 2007 Mar 15;92(6):2120-30. DOI:10.1529/biophysj.106.096016 | PubMed ID:17208966 | HubMed [FecAPorins16]

All Medline abstracts: PubMed | HubMed