IGEM:Harvard/2007/Laboratory Notebooks/Two Component System: Difference between revisions
No edit summary |
No edit summary |
||
| Line 125: | Line 125: | ||
-Ordered sequencing primers for our Fec promoter-GFP construct. plate 50uL of cells, also 5uL cells with 45uL LB.<br> | -Ordered sequencing primers for our Fec promoter-GFP construct. plate 50uL of cells, also 5uL cells with 45uL LB.<br> | ||
-In place of GPF construct E0240, which has been shown not to work, we have changed to I13507, for RFP. This will not create a problem since the constructs 1 and 2 that we designed are simply the Fec promoter. We will do a ligation to ligate the fec promoter to I13507.<br> | -In place of GPF construct E0240, which has been shown not to work, we have changed to I13507, for RFP. This will not create a problem since the constructs 1 and 2 that we designed are simply the Fec promoter. We will do a ligation to ligate the fec promoter to I13507.<br> | ||
'''7/20/07'''<br> | '''7/20/07'''<br> | ||
| Line 138: | Line 139: | ||
-Tested induction with 8mM citrate: no fluorescence.<br> | -Tested induction with 8mM citrate: no fluorescence.<br> | ||
-retransformed Fec responsive RFP construct.<br> | -retransformed Fec responsive RFP construct.<br> | ||
'''7/23/07''' | '''7/23/07''' | ||
| Line 145: | Line 147: | ||
-Colony PCR to determine if our RFP constructs are correct and working.<br> | -Colony PCR to determine if our RFP constructs are correct and working.<br> | ||
-Put constitutive GFP into broth for later use, trying to see how GFP expression looks in broth.<br> | -Put constitutive GFP into broth for later use, trying to see how GFP expression looks in broth.<br> | ||
'''7/24/07''' | '''7/24/07''' | ||
| Line 160: | Line 163: | ||
YAY! The current overnight assay in the plate reader is AA93 and co-transformed AA93 with 1:100, 1:500, and 1:1000 cell dilution. We used 3uL of 10mM sodium citrate with 300uL of broth. We also used 3uL, 0.6uL and 0.3uL of cells for the respective dilutions. Results in 15 hours!!! (or more since we aren't coming in at 5:30am tomorrow).<br> | YAY! The current overnight assay in the plate reader is AA93 and co-transformed AA93 with 1:100, 1:500, and 1:1000 cell dilution. We used 3uL of 10mM sodium citrate with 300uL of broth. We also used 3uL, 0.6uL and 0.3uL of cells for the respective dilutions. Results in 15 hours!!! (or more since we aren't coming in at 5:30am tomorrow).<br> | ||
'''7/25/07''' | |||
-Further "YAY!"ing has been postponed due to a failure to induce GFP expression. In other words: NO FLUORESCENCE!!<br> | |||
-Upon checking the results of the plate reader by using the microscope, it was confirmed that there were NO CELLS in the samples. Which makes sense given that the wells were not cloudy. We have grown our cotransformed AA93 cells in 1:1 dilution with both WL and LB, neither of which grows appreciably faster. Having our cell density ready for another overnight run is highly unlikely.<br> | |||
-In addition, we are doing a colony PCR to see if our AA93s are in fact CO-transformed.<br> | |||
Revision as of 18:28, 25 July 2007
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.
The oligos ordered were as follows:
Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’
Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
[edit]
6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:
SV001 - FecA plus VF2
SV002 - FecA plus VR
SV003 - FecR plus VF2
SV004 - FecR plus VR
SV005 - FecI plus VF2
SV006 - FecI plus VR
PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors
6/28/07
Miniprep done. Sent for sequencing.
Emails sent to:
Duke:
Dr. Homme W. Hellinga
Dr. Loren L. Looger
Penn State:
Dr. Hossein Fazelinia
Dr. Costas D. Maranas
Dr. Gregory L. Moore
PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors
6/29/07
Reply from George Khoury of Penn State lab under Maranas. He has agreed to assist us with computational design.
Week of 7/1/07
Continued contact with George Khoury, including a cell phone conversation w/ Ellenor on 7/3/07 and an in-person talk w/ Shaunak to be scheduled for 7/7/07. We've decided on lead (Pb) a small molecule ligand and Muc1 as a macromolecule (glycoprotein) ligand for FecA. Muc1 is a cancer antigen, a glycoprotein overexpressed on tumor cells. They are underglycolysated on cancerous cells.
7/5/07
Directed Mutagenesis of FecA and FecR to remove Pst1 restriction site.
7/6/07
Transformation of FecA' and FecR' (pending recovery of previous day's PCR product)
Also, Shaunak and George's meeting went well. Notes are under "Brainstorming"
Weekend of 7/7/07
7/7/07: Transformation of FecA' and FecR' into cells, completing the Quickchange Kit protocol.
7/8/07: Growth of liquid cultures from mutagenesis.
7/9/07
- miniprep of site directed mutagenesis using QiaGen Miniprep kit
- Plates streaked with cells containing FecA' and FecR' from liquid cultures.
- Digestion with Pst1 performed on a portion of miniprepped plasmids and on plasmids containing FecA and FecR.
- Egel was run to determine whether the mutagenesis was successful. FecA' (A1B) and FecR' (R5B) were placed into liquid culture from previously streaked plate. FecI was grown in liquid culture. The mutagenesis looks successful.
- purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick'
- received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them.
- grow E0240 in liquid culture
7/13/07
-Have grown up German constructs in LB, will be doing plasmid minipreps on pGFPA', pLCIRA in order to electroporate into AA93.
-plasmid minipreps done, pGFPA' is 205.2 ng/ul, pLCIRA is 53.2 ng/ul
-electroporation (see general protocol)--used 1 mL of AA93 cells, 25 ng of each plasmid (pGFPA' and pLCIRA): 2 samples, T1 (time constant 5.2) and T2 (time constant 5.0)
7/17/07 - 7/18/07 Fec signal induction
Day 1:
-Prepare WL nutrient broth for use in liquid culture. Grow overnight; should be a color change from deep blue toward green or yellow.
-Make 1mM and 4mM solutions of sodium citrate and ferric citrate.
-Make a 50uM solution for dipyridyl.
-In 96-well plate, use relevant combinations of 200 uL of cells, 50 uL of sodium- or ferric-citrate, and 50 uL of dipyridyl.
Results: NO FLUORESCENCE
Day 2:
-Take 200uL samples of T1 in WL (8 used).
-Spin down half of these samples and resuspend in 200uL of LB.
-Add Carb and Chloro... to challenge. Add relevant combinations of 50uL of 4mM sodium- or ferric- citrate.
-Grow all in small liquid culture tubes for an hour.
-Add 100uL of 50mM dipyridyl to appropriate liquid cultures. Let continue growing for 40 minutes.
-Transfer to 1.5 mL centerfuge tubes. Spin for 1 min at 13000rpm. Resuspend in 300uL PBS. Repeat until WL color is not visible in resuspension.
-Add 200uL of resuspensions to 96-well plate. Check for fluorescence using plate reader, fluorometric microscope etc.
Results: NO FLUORESCENCE
7/19/07
-Restarting from transformation phase. Electroporation of regrown AA93 and pGFPA in AA93. Double transformation of pGFPA and pLCIRA into AA93, 25 ng each. Transformation of 50ng pLCIRA into pGFPA-containing cells. plate 250uL.
-Parallel chemical transformations, using 1uL of pGFPA for one transformation and 1uL of each of the plasmids for double transformation into NovaBlue Cells (already have have Fec system in place).
-Ordered sequencing primers for our Fec promoter-GFP construct. plate 50uL of cells, also 5uL cells with 45uL LB.
-In place of GPF construct E0240, which has been shown not to work, we have changed to I13507, for RFP. This will not create a problem since the constructs 1 and 2 that we designed are simply the Fec promoter. We will do a ligation to ligate the fec promoter to I13507.
7/20/07
-Results of yesterday's transformations suggest that chemical transformation is more effective than electroporation, at least for the protocols we have used. Results also show that single tranformation of pCLIRA is much more effective than cotransformation of pCLIRA and pGFP.
-Digestion of I13507 using EcoR1 and Xba and EcoR1 and Spe for Fec (F).
-PCR purification of I13507 and nucleotide removal for Fec.
-Ligation of digestion products and transformation into chemically competent cells.
-Liquid culture of transformed plasmid.
-PIZZA!!
weekend, 7/21/07
-Tested induction with 8mM citrate: no fluorescence.
-retransformed Fec responsive RFP construct.
7/23/07
-Made the pGFPA' sequencing primer and sent for sequencing.
-Did assays using dipyridyl, then a delay, then sodium or ferric citrate. Used 8mM of citrates, added 4uL of dip to 150uL of citrates and 1mL of cells. NO FLUORESCENCE!
-Replenished cell stocks for assay.
-Colony PCR to determine if our RFP constructs are correct and working.
-Put constitutive GFP into broth for later use, trying to see how GFP expression looks in broth.
7/24/07
-Looked at constitution GFP in LB and WL and certain promising assay samples under fluorometric microscope. Again, no fluorescence from our assays. The constitutive GFP worked as expected. GFP: 485 excitation, 538 emission.
-Shaunak received an email back from Ferguson who co-authored a paper working with Fec induction.
Key points:
1) Do 1:100 - 1:1000 dilution because 1:1 puts cells almost in log phase.
2) Citrate induction takes about 8 hours. Monitor for 8-12 hours at 37C.
3) WL broth should not cause visualization problems.
4) Do not add dipyridyl.
5) Inducing in LB won't work.
6) German constructs are probably not the issue.
YAY! The current overnight assay in the plate reader is AA93 and co-transformed AA93 with 1:100, 1:500, and 1:1000 cell dilution. We used 3uL of 10mM sodium citrate with 300uL of broth. We also used 3uL, 0.6uL and 0.3uL of cells for the respective dilutions. Results in 15 hours!!! (or more since we aren't coming in at 5:30am tomorrow).
7/25/07
-Further "YAY!"ing has been postponed due to a failure to induce GFP expression. In other words: NO FLUORESCENCE!!
-Upon checking the results of the plate reader by using the microscope, it was confirmed that there were NO CELLS in the samples. Which makes sense given that the wells were not cloudy. We have grown our cotransformed AA93 cells in 1:1 dilution with both WL and LB, neither of which grows appreciably faster. Having our cell density ready for another overnight run is highly unlikely.
-In addition, we are doing a colony PCR to see if our AA93s are in fact CO-transformed.