Cfrench:primerlist: Difference between revisions
No edit summary |
No edit summary |
||
| Line 162: | Line 162: | ||
*Date: 21 August 2006 | *Date: 21 August 2006 | ||
*Purpose: | *Purpose: | ||
*Restriction sites: SpeI | |||
*Notes: | |||
'''XWlaczZf1''' cctttctagatgaccatgattacggattc | |||
*Date: 27 Feb 2007 | |||
*Purpose: amplification of ''lacZ'' coding sequence (without rbs) from ''E. coli''. | |||
*Restriction sites: XbaI | |||
*Notes: | |||
'''XWlacZr1''' aaggctgcagcggccgctactagtattattactccagccagctttcc | |||
*Date: 27 Feb 2007 | |||
*Purpose: amplification of ''lacZ'' coding sequence with TAA TAA double stop codon introduced after codon 76. | |||
*Restriction sites: PstI, NotI, SpeI | |||
*Notes: | |||
'''eclacyf1''' ggcgagctctgcccgtatttcgcgtaag | |||
*Date: 1 Sep 2006 | |||
*Purpose: testing for presence of intact ''lacY'' in ''E. coli'' strains. | |||
*Restriction sites: SacI. | |||
*Notes: Also could be used to clone ''lacY'' as a biobrick using SacI/SpeI sites in an Edinbrick vector. | |||
'''eclacyr1''' gatactagtcgcgccgcatccgacattg | |||
*Date: 1 Sep 2006 | |||
*Purpose: as above. | |||
*Restriction sites: SpeI | *Restriction sites: SpeI | ||
*Notes: | *Notes: | ||
Revision as of 17:50, 16 August 2007
Catalog of primers
Primers for iGEM2007 flavours/fragrances project
echf1 aat gaattc gcggccgc t tctag atg agc aaa tac gaa ggt c
- Purpose: forward primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: EcoRI, XbaI
- Notes: no ribosome binding site included.
echr1 ct actagt a tta tta gcg ttt ata ggc ttg cag c
- Purpose: reverse primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: SpeI only.
- Notes: replaces TGA stop codon with TAA TAA. Also replaces PstI site in coding sequence with silent mutation.
fcsf1 aat gaattc gcggccgc t tctag atg cgc tcc ctg gaa ccc
- Purpose: forward primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: EcoRI, XbaI
- Notes: no ribosome binding site included.
fcsr1 ct actagt a tta tta cgg ttt ggg ccc ggc ac
- Purpose: reverse primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: SpeI only.
- Notes: replaces TGA stop codon with TAA TAA.
Ms_COMTf1 aat gaattc gcggccgc t tctag atg ggt tca aca ggt gaa ac
- Purpose: forward primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
- Restriction sites: EcoRI, XbaI.
- Notes: eukaryotic gene, no ribosome binding site.
Ms_COMTr1 ct actagt a tta tta aac ctt ctt aag aaa ctc c
- Purpose: reverse primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
- Restriction sites: SpeI only (NOT PstI).
- Notes: adds TAA TAA stop codons.
echf2 atc gagctc acacc cagaa caaga gc
- Date: 9 August 2007.
- Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SacI
- Notes: this was made because no product was obtained with echf1 and echr1.
echr2 tt actagt atcgg gaaca cgttc aagc
- Date: 9 August 2007.
- Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SpeI
- Notes: this was made because no product was obtained with echf1 and echr1.
fcsf2 gtg gagctc actga agaac agggc gtg
- Date: 9 August 2007.
- Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SacI
- Notes: this was made because no product was obtained with fcsf1 and fcsr1.
fcsr2 aa actagt atgcc gtgac agcaa atagg
- Date: 9 August 2007.
- Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SpeI
- Notes: this was made because no product was obtained with fcsf1 and fcsr1.
sam5f1 at gaattc gcggccgc t tctag atg acc atc acg tca cct g
- Date: 9 August 2007.
- Purpose: amplify sam5 from Saccharothrix espanaensis.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: coding sequence only, no ribosome binding site.
sam5r1 ct actagt a tta tta ggt gcc ggg gtt gat cag
- Date: 9 August 2007.
- Purpose: amplify sam5 from Saccharothrix espanaensis.
- Restriction sites: SpeI (not PstI!)
- Notes: coding sequence modified to end with TAA TAA.
sam8f1 at gaattc gcggccgc t tctag atg acg cag gtc gtg gaa cg
- Date: 9 August 2007.
- Purpose: amplify sam8 from Saccharothrix espanaensis.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: coding sequence only, no ribosome binding site.
sam8r1 ct actagt a tta tta tcc gaa atc ctt ccc gtc
- Date: 9 August 2007.
- Purpose: amplify sa85 from Saccharothrix espanaensis.
- Restriction sites: SpeI (not PstI!)
- Notes: coding sequence modified to end with TAA TAA.
Primers for iGEM2007 bioswitches project
revPlacf1 tcta gagctc tgtgtgaaattgttatccg
- Purpose: forward biobrick primer for making a reverse lac promoter.
- Restriction sites: XbaI (probably won't cut as right at end), SacI
revPlacr1 ct actagt a caatacgcaaaccgcctc
- Purpose: reverse biobrick primer for making a reverse lac promoter.
- Restriction sites: SpeI only.
Primers for working with biobricks
pSB1A3f1 tccttagctttcgctaagg
- Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick prefix)
pSB1A3r1 agggtggtgacaccttgc
- Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick suffix)
pSB1A2insf1 cgctaaggatgatttctgg
- Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick prefix)
- Notes: excellent resuts for sequencing.
pSB1A2insr1 gtcagtgagcgaggaagc
- Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick suffix)
- Notes: excellent resuts for sequencing.
bbinsertf1 attc gcggccgc t tctag
- Purpose: sequencing or amplification of any biobrick insert
- Restriction sites: only NotI, but amplification product will have XbaI, and SacI if present.
- Note: gives good results for sequencing, but pSB1A2insf1 is better.
bbinsertr1 tgcag cggccgc t actag
- Purpose: sequencing or amplification of any biobrick insert
- Restriction sites: only NotI, but amplification product will have SpeI.
- Note: usually not very good results for sequencing.
bbvectorf1 ag t actag ta gcggccg ctgc
- Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick suffix and amplifies vector region.
- Restriction sites: SpeI, NotI; amplification product will also have PstI.
bbvectr1 cctt gagctc taga a gcggccgc gaattc
- Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick prefix and amplifies vector region.
- Restriction sites: SacI, XbaI, EcoRI.
Primers for 'Bacillobrick' project
Primers for Bacillus subtilis ureABC genes
Primers for Escherichia coli lac' genes
laczf1 cctttctagaggaggaaacagctatgacc
- Date: 11 Jul 06
- Purpose: amplification of lacZ' from E. coli BS with its native ribosome binding site.
- Restriction sites: XbaI only
- Notes:
laczf2 ggtctagagctcatgttatatcccg
- Date: 18 July 2006
- Purpose:
- Restriction sites: XbaI
- Notes:
laczf3 gggtcgacaggtttcccgactg
- Date: 18 July 2006
- Purpose:
- Restriction sites:
- Notes:
laczr1 aaggctgcagcggccgctactagtatcactccagccagctttc
- Date: 11 July 2006
- Purpose:
- Restriction sites: PstI, NotI, SpeI
- Notes: Designed to produce a truncated version of lacZ with stop codon TGA at position 77, but also produces minor product truncated with stop codon at position 137, reason unclear.
Eclacr2 gttactagtgtgaaattgttatccgc
- Date: 21 August 2006
- Purpose:
- Restriction sites: SpeI
- Notes:
XWlaczZf1 cctttctagatgaccatgattacggattc
- Date: 27 Feb 2007
- Purpose: amplification of lacZ coding sequence (without rbs) from E. coli.
- Restriction sites: XbaI
- Notes:
XWlacZr1 aaggctgcagcggccgctactagtattattactccagccagctttcc
- Date: 27 Feb 2007
- Purpose: amplification of lacZ coding sequence with TAA TAA double stop codon introduced after codon 76.
- Restriction sites: PstI, NotI, SpeI
- Notes:
eclacyf1 ggcgagctctgcccgtatttcgcgtaag
- Date: 1 Sep 2006
- Purpose: testing for presence of intact lacY in E. coli strains.
- Restriction sites: SacI.
- Notes: Also could be used to clone lacY as a biobrick using SacI/SpeI sites in an Edinbrick vector.
eclacyr1 gatactagtcgcgccgcatccgacattg
- Date: 1 Sep 2006
- Purpose: as above.
- Restriction sites: SpeI
- Notes:
Primers for chromogenic reporter genes
Template
primer
- Date
- Purpose:
- Restriction sites:
- Notes: