Julius B. Lucks/Antisense RNA Transcription Attenuation/Kinefold Results: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 44: Line 44:
T 62 80 4
T 62 80 4
</pre>
</pre>
[[Image:JBLucks_pT181_RNAI_BWF2B_pseudo.jpg]]
[[Image:JBLucks_pT181_RNAI_BWF2B_no_pseudo.jpg]]

Revision as of 03:14, 1 February 2008

Goal

Test wether or not the Kinefold RNA folding program produces the experimentally determined folds of RNAII/RNAIII. If this is true, then use it to identify a target region that we could mutate that would not drastically affect the secondary structure of RNAIII/II.

Kinefold is an RNA folding program that uses a kinetic, rather than a thermodynamic algorithm. It is thus able to identify kinetically trapped RNA folds, and able to incorporate pseudoknots. See http://kinefold.curie.fr for more information.

Initial Test

In (S Brantl, E G Wagner Mol Microbiol (2000) vol. 35 (6) pp. 1469-82), took sequence of RNAI (antisense RNA), and repC-RNA_132 (intermediate target RNA that looks like in the middle of the 2 hairpin, and the non-attenuateable fold. Folded in kinefold.

  • both RNAI and RNAII affective at attenuation - RNAI shorter

RNAI

  • 85nt
  • sequence: AUACAAGAUUAUAAAAACAACUCAGUGUUUUUUUCUUUGAAUGAUGUCGUUCACAAACUUUGGUCAGGGCGUGAGCGACUCCUU

Kinefold Request

Sequence name: pT181RNAIF2B 

Sequence :
AUACAAGAUUAUAAAAACAACUCAGUGUUUUUUUCUUUGAAUGAUGUCGUUCACAAACUUUGGUCAGGGCGUGAGCGACUCCUU
 
RNA sequence

Type of Stochastic Simulation:   Co-transcriptional Fold... A new base is added every 20.000000 milliseconds.

No Simulated molecular time requested.    Kinefold estimation : 2500 ms

Pseudoknots:   Allowed

Entanglements:   Non crossing

Random seed: 97972

***********************************************************************

Actual sequence folded :
AUACAAGAUUAUAAAAACAACUCAGUGUUUUUUUCUUUGAAUGAUGUCGUUCACAAACUUUGGUCAGGGCGUGAGCGACUCCUU

Actual Traced and Forced Helices :
T 46 79 9
T 13 32 7
T 38 53 6
T 35 69 6
T 62 80 4