IGEM:Harvard/2008/Lab Notebooks/DailyBook/Week5/Chemical and Light: Difference between revisions
Meng Xiao He (talk | contribs) No edit summary |
|||
| Line 221: | Line 221: | ||
|- | |- | ||
| Total||25 uL||25 uL||25 uL | | Total||25 uL||25 uL||25 uL | ||
|} | |||
===Digestion Gel Results 7/23=== | |||
{| {{table}} | |||
!rowspan=8|[[Image:7-23 digest lts.jpg]] | |||
!colspan=2 align="center" style="background:#f0f0f0;"|'''1% Agarose, visualized using EtBr/UV''' | |||
|- | |||
| align="center" style="background:#f0f0f0;"|'''Lane''' | |||
| align="center" style="background:#f0f0f0;"|'''Sample''' | |||
|- | |||
| 1||1kB Ladder | |||
|- | |||
| 3||S1 P75a (2750/925) | |||
|- | |||
| 4||100bp Ladder | |||
|- | |||
| 5||S1 P75b 1 (2750/925) | |||
|- | |||
| 7||P64a 07 (~3kb/129bp) | |||
|- | |||
| 9||1kB Ladder | |||
|} | |} | ||
Revision as of 19:05, 26 July 2008
Testing Thermoinducible Lac System
Restreaked Plates of P92-3 in S1 7/21
Restreaked P93 (1:3), P92a, and P93b--all successfully transformed in S1--to detect YFP at 30 and 40 degrees.
Results 7/22
S1 P93 (1:3), P92a, and P93b plates grown at 30 and 40 degrees failed to demonstrate any difference in YFP expression. Both expressed very low, if any, YFP.
Sequencing Parts, Plasmids, Etc.
Primers for Sequencing Remy's Plasmids and Duet Vectors 7/21
| Primer Name | Sequence |
| P4P13fwd | GGATCTCGACGCTCTCCCTT |
| P12fwd | ATGCGTCCGGCGTAGAGGA |
| DuetRev | TGCTAGTTATTGCTCAGCGG |
Analytical Digest of Composite Parts 7/22
Digested composite plasmids to verify size.
| Plasmid | DNA Added (uL) | 10x Buffer 3 (uL) | 100x BSA (uL) | XbaI (uL) | PstI (uL) | Water (uL) | Total (uL) | < 1 ug DNA? | Expected Size |
| S1 P75a 1 (7/22) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 925bp, 2750bp | |
| S1 P75a 2 (7/22) | 5 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 15.25 | 25 uL | 925bp, 2750bp | |
| S1 P75b 1 (7/22) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 925bp, 2750bp | |
| S1 P75b 2 (7/22) | 4 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 16.25 | 25 uL | 925bp, 2750bp | |
| E1 P92a 1:1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| E1 P92b 1:1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| E1 P93a 1:1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| E1 P93b 1:1 (7/17) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | 2314bp, 2750bp | |
| E1 P92a PCR (7/18) | 15 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 5.25 | 25 uL | Yes | 2314bp, 2750bp |
| S1 P93 1:3 1 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| S1 P93 1:3 2 (7/17) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| S1 P92a PCR 1 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| S1 P92a PCR 2 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| S1 P93b PCR 1 (7/18) | 4 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 16.25 | 25 uL | 2314bp, 2750bp | |
| S1 P93b PCR 2 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 2314bp, 2750bp | |
| E1 P58b 1 (7/18) | 7 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 13.25 | 25 uL | 937bp, 2750bp | |
| E1 P58b 2 (7/18) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | 937bp, 2750bp | |
| S1 P58b A (7/15) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 937bp, 2750bp |
| S1 P58b B (7/15) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 937bp, 2750bp |
| S1 P59 (7/9) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 1122bp, 2750bp |
| S1 P59b 1 (7/22) | 10 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 10.25 | 25 uL | Yes | 1122bp, 2750bp |
| S1 P59b 2 (7/18) | 3 | 2.5 uL | 0.25 uL | 1 uL | 1 uL | 17.25 | 25 uL | 1122bp, 2750bp |
Gel Results 7/23
Making Thermoinducible cI Lambda System
Primers for Taking Out cI857 from PGW7 7/21
| Primer Name | Sequence |
| CI857_RBSfwd | Atcgagaattcgcggccgcttctagagaaagaggagaaaatgagcacaaaaaagaaac |
| CI857_RBSrev | Atcgatactagtagcggccgctgcagtcagccaaacgtctcttcag |
| CI857_BIGfwd | Atcgagaattcgcggccgcttctagagtcatgacattaacctataaa |
| CI857_BIGrev | atcgatactagtagcggccgctgcagcagccagcagagaattaagg |
Minipreps of Transformed Parts in S1 7/22
Also includes transformed P28 and the thermoinducible lac system.
| Plasmid Name | ng/uL | A260 | 260/280 | 260/230 | Constant |
| S1 P75a 1 | 156.2 | 3.124 | 1.99 | 2.27 | 50 |
| S1 P75a 2 | 203.24 | 4.065 | 2.04 | 2.23 | 50 |
| S1 P75b 1 | 177.41 | 3.548 | 2.02 | 2.16 | 50 |
| S1 P75b 2 | 258.85 | 5.177 | 2.01 | 2.3 | 50 |
| S1 P28a 1 | 155.42 | 3.108 | 2.03 | 2.27 | 50 |
| S1 P28a 2 | 239.51 | 4.79 | 2.06 | 2.26 | 50 |
| S1 P28a 3 | 204.5 | 4.09 | 2.01 | 2.24 | 50 |
| S1 P93 1:3 1 | 175.27 | 3.505 | 2.07 | 2.32 | 50 |
| S1 P93 1:3 2 | 166.9 | 3.338 | 2.12 | 2.38 | 50 |
| S1 P92a PCR 1 | 152.58 | 3.052 | 2.02 | 2.28 | 50 |
| S1 P92a PCR 2 | 157.59 | 3.152 | 2.02 | 2.22 | 50 |
| S1 P93b PCR 1 | 291.87 | 5.837 | 2.13 | 2.23 | 50 |
| S1 P93b PCR 2 | 152 | 3.04 | 2.07 | 2.21 | 50 |
Adding Terminator Before pLambda GFP
Digestion of Terminator (P64) and pLambda GFP 7/22
| ' | P75a 1 (vector) | P75b 1 (vector) | P64a 07 (insert) |
| DNA | 10 uL | 10 uL | 10 uL |
| 100x BSA | 0.25 uL | 0.25 uL | 0.25 uL |
| 10x Buffer | 2.5 uL EcoRI buffer | 2.5 uL EcoRI buffer | 2.5 uL EcoRI buffer |
| Enzyme 1 | 1 uL EcoRI | 1 uL EcoRI | 1 uL EcoRI |
| Enzyme 2 | 1 uL XbaI | 1 uL XbaI | 1 uL SpeI |
| Water | 5.25 uL | 5.25 uL | 5.25 uL |
| Total | 25 uL | 25 uL | 25 uL |
Digestion Gel Results 7/23
|
1% Agarose, visualized using EtBr/UV | |
|---|---|---|
| Lane | Sample | |
| 1 | 1kB Ladder | |
| 3 | S1 P75a (2750/925) | |
| 4 | 100bp Ladder | |
| 5 | S1 P75b 1 (2750/925) | |
| 7 | P64a 07 (~3kb/129bp) | |
| 9 | 1kB Ladder | |
Housekeeping
Making Competent Cells 7/22
Made ~600 100uL (some were 200 uL, indicated by green dot on top) aliquots from 1L of culture. Done as per Jason's lab's protocol.
PCR
mtrB
7/22: gradient + new R primer
Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of mtrB BB from gel purification, 12μL water Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52-58 gradient}°C → 2m38s @72°C] → 5min @ 72°C → ∞ @ 4°C
No bands on gel from any of the conditions.
Lower gradient
Rx mix (split into 12 samples): 180μL PCR supermix, 4μL mtrB-ApaLI-F primer (20μM), 4μL mtrB-KpnI-R-new (20μM), pipet tip touch of WT S. oneidensis MR-1, 12μL water Rx: 10min @ 94°C → 40x[45s @ 94°C → 45s @ {44-51 gradient}°C → 2m45s @72°C] → 5min @ 72°C → ∞ @ 4°C
7/23: gel
All the temperatures seem to have worked (51 was not loaded due to # lanes on gel). Expected product size ~2.1kb. Ladder is 1KB.
Products from different temperatures combined and gel purified.
P51, 52, 17 MIT
17, 52:
Rx mix (split into 4 samples): 180μL Platinum PCR supermix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 8μL water
51:
Rx mix (split into 4 samples): 100μL AmpliTaq Gold Master Mix, 4μL BBpfx primer (20μM), 4μL BBsfx primer (20μM), 4μL miniprepped DNA, 88μL water
Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {52.7, 53.6, 54.6, 55.5}°C → 1m25s @72°C] → 5min @ 72°C → ∞ @ 4°C
Results
P1, P3 backbones; HO-pcyA; P51 MIT
Conditions optimization
Rx: 5min @ 94°C → 35x[45s @ 94°C → 45s @ {middle 8 of 41-55 gradient: 43.3, 44.9, 47.0, 49.3, 51.3, 52.8, 53.9, 54.7}°C → 3m30s @72°C] → 5min @ 72°C → ∞ @ 4°C
P1, P3
PCR product is the backbone of P1 and P3, including the RBS (B0032), weak and strong promoter respectively, and terminator. The ends have unique ApaLI and KpnI cut sites.
Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL P3minusGFP-F primer (20μM), 4μL P3minusGFP-R primer (20μM), 4μL miniprepped DNA (P1/P3), 8μL water
HO-pcyA
Ends have unique ApaLI and KpnI cut sites.
Rx mix (split into 8 samples): 180μL Platinum PCR supermix, 4μL HO-pcyA-F primer (20μM), 4μL HO-pcyA-R primer (20μM), 4μL miniprepped P86, 8μL water
P51 MIT
Rx mix (split into 4 samples): 90μL Platinum PCR supermix, 2μL BBsfx primer (20μM), 2μL BBpfx primer (20μM), 2μL miniprepped P51, 4μL water
Used highest 4 temps of gradient.
Gels
Annealing temp increases LTR.
|
1.2% agarose E-gel run for 30 min and visualized using EtBr/UV | |
|---|---|---|
| Lane | Contents | |
| 1-8 | P1 backbone (~3kb) | |
| 9 | 1 KB ladder | |
| 10-12 | HO-pcyA (~1.4 kb) | |
|
1.2% agarose E-gel run for 30 min and visualized using EtBr/UV | |
|---|---|---|
| Lane | Contents | |
| 1-5 | HO-pcyA (~1.4 kb) | |
| 6 | 1 KB ladder | |
| 7-12 | P3 backbone (~3 kb) | |
|
1.2% agarose E-gel run for 30 min and visualized using EtBr/UV | |
|---|---|---|
| Lane | Contents | |
| 1-2 | P3 backbone (~3kb) | |
| 3 | 1 KB ladder | |
| 4-7 | P51 MIT (~1.4 kb) | |
Full Rx
400 μL (8 reactions) each of P1 and P3 were set up using a doubling of above reaction mix. The reaction conditions were the same except that annealing temperature was 45°C, and cycles occur 40 times.
100 μL (2 reactions) each of HO-pcyA and P51 MIT were set up using above reaction ratios. 40 cycles were performed with 55°C annealing temp and 1:35 extension time.
Products will be gel purified along with products from optimization PCRs.
RE digests 07/22
Gel 1
Gel 2
Gel 3
|
1 agarose gel visualized using EtBr/UV | |
|---|---|---|
| Lane | Contents | |
| 1 | 1 kb plus ladder | |
| 2 | P97A cut EX (2091) | |
| 3 | P97A uncut (2091) | |
| 4 | P97B cut EX (2091) | |
| 5 | P97B uncut (2091) | |
Cool ligations 07/22
- We ligated P1A (vector) to CDF. We used three different ratios of vector to insert for the ligation: 2/6, 1/5, 1/7.
- Attempted to ligate p40 cut with SP (w/ RBS) to mtrB cut with XP. Thus far, the ligation has not worked.
Recombination Update 07/22
- Thus far, none of the attempts to extract flanking regions from the genomic DNA have worked. We are troubleshooting this now and will run positive controls with known DNA samples to check the efficiency of our Phusion Polimerase.
07/23 Ligations/Transformations
- Ligated p40 cut SP with mtrB cut XP at 2:3, 1:2, 1:4, 1:5, 1:6, positive control is uncut p40, negative control (to test Amp plates) is p29 (Kan)
RE digests 07/23
Ligations 07/23: mtrB+RBS, CDF into pSB3K3
We ligated
- P97 and mtrB BB
- P3 and CDF
We used three different ratios of insert to vector for the ligation: 6/2, 5/1, 7/1.
We used 5 μL of the ligation to transform TOP10 cells and 5 μL to transform the new DH5α cells. We also used 1 μL and 3 μL to transform DH5α. We used pUC19 (1 μL) as a positive control to test the efficacy of the new DH5α cells.
We used Jason's protocol to transform the new DH5α cells:
- Thaw cells by resting tubes on ice
- Then add DNA and mix by swirling with the pipette tip
- Incubate the cells with DNA in ice for 10min
- Heat shock at 42C for 2min
- Then incubate in ice for 2-5min
- Add 500-700ml LB (or SOC) and incubate + 250rpm shaking for 1hr at 37C
- Plate
Results
| Strain | DNA | Vector:Insert (μL) | Amount transformed (μL) | Plate | # colonies |
| E1 | pUC19 | n/a | 1 | AMP | 40 |
| E1 | - | n/a | - | CARB | 0 |
| E2 | P97+ mtrB BioBrick | 2:6 | 5 | CARB | 136 |
| E2 | P97+ mtrB BioBrick | 1:5 | 5 | CARB | 48 |
| E2 | P97+ mtrB BioBrick | 1:7 | 5 | CARB | 64 |
| E1 | P97+ mtrB BioBrick | 1:7 | 1 | CARB | 0 |
| E1 | P97+ mtrB BioBrick | 1:7 | 3 | CARB | 0 |
| E1 | P97+ mtrB BioBrick | 1:7 | 5 | CARB | 4 |
| E1 | P97+ mtrB BioBrick | 1:5 | 1 | CARB | 0 |
| E1 | P97+ mtrB BioBrick | 1:5 | 1 | CARB | 0 |
| E1 | P97+ mtrB BioBrick | 1:5 | 1 | CARB | 0 |
| E1 | P97+ mtrB BioBrick | 2:6 | 1 | CARB | 1 |
| E1 | P97+ mtrB BioBrick | 2:6 | 1 | CARB | 7 |
| E1 | P97+ mtrB BioBrick | 2:6 | 1 | CARB | 9 |
| E2 | P3+CDF | 2:6 | 5 | KAN | 7 |
| E2 | P3+CDF | 1:5 | 5 | KAN | 56 |
| E2 | P3+CDF | 1:7 | 5 | KAN | 5 |
| E1 | P3+CDF | 1:7 | 1 | KAN | 0 |
| E1 | P3+CDF | 1:7 | 3 | KAN | 2 |
| E1 | P3+CDF | 1:7 | 5 | KAN | 0 |
| E1 | P3+CDF | 1:5 | 1 | KAN | 0 |
| E1 | P3+CDF | 1:5 | 3 | KAN | 0 |
| E1 | P3+CDF | 1:5 | 5 | KAN | 0 |
| E1 | P3+CDF | 2:6 | 1 | KAN | 0 |
| E1 | P3+CDF | 2:6 | 3 | KAN | 1 |
| E1 | P3+CDF | 2:6 | 5 | KAN | 0 |
- Try 45s heat shock and SOC for new cells
- Try 3 or 5 μL transformations
- New Carb plates seem fine
Ligations 07/24
We ligated p75a w/ p63 w/ a ratio of 4ul p63:1ul p75a
Transformed into new dh5α competent cells w/ volumes of 1, 3, and 5uL, using Jason's new protocol. As a control transformed 1uL of pUC19.
RE digests 07/24
Cool ligations 07/24
RE digests 07/25
0000
| DNA | Strain | Plate | # Colonies |
| P1+P17 | E2 | KAN | 184 |
| P1+P17 | E1 | KAN | 9 |
| P1+P17 | E1 | KAN | 9 |
| P1+P52 | E2 | KAN | 40 |
| P1+P52 | E1 | KAN | 0 |
| P1+P52 | E1 | KAN | 0 |
| P3+P17 | E2 | KAN | 10 |
| P3+P17 | E1 | KAN | 0 |
| P3+P17 | E1 | KAN | 0 |
| P3+P52 | E2 | KAN | 48 |
| P3+P52 | E1 | KAN | 1 |
| P3+P52 | E1 | KAN | 1 |
| P38+P17 | E2 | KAN | 1 |
| P38+P17 | E1 | KAN | 0 |
| P38+P17 | E1 | KAN | 0 |
| P38+P51 | E2 | KAN | 32 |
| P38+P51 | E1 | KAN | 1 |
| P38+P51 | E1 | KAN | 0 |
| P38+P52 | E2 | KAN | 1 |
| P38+P52 | E1 | KAN | 0 |
| P38+P63 | E1 | KAN | 0 |
| P39+P17 | E1 | KAN | 0 |
| P39+P17 | E1 | KAN | 0 |
| P39+P17 | E2 | KAN | 0 |
| P39+P51 | E2 | KAN | 5 |
| P39+P51 | E1 | KAN | 2 |
| P39+P51 | E1 | KAN | 2 |
| P39+P52 | E2 | KAN | 6 |
| P39+P52 | E1 | KAN | 1 |
| P39+P52 | E1 | KAN | 1 |
| P90+P48 | E2 | CM | 16 |
| P90+P48 | E1 | CM | 5 |
| P90+P48 | E1 | CM | 1 |
| P90+P49 | E2 | AMP | TMTC |
| P90+P49 | E1 | AMP | 19 |
| P90+P49 | E1 | AMP | 4 |
| pUC19 | E1 | AMP | 192 |














